ID: 949099706

View in Genome Browser
Species Human (GRCh38)
Location 3:129243-129265
Sequence TTGCCCCAACTCTATATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949099703_949099706 4 Left 949099703 3:129216-129238 CCATGTATAAAATTAGGCCACCT No data
Right 949099706 3:129243-129265 TTGCCCCAACTCTATATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949099706 Original CRISPR TTGCCCCAACTCTATATTTT TGG Intergenic
No off target data available for this crispr