ID: 949100809

View in Genome Browser
Species Human (GRCh38)
Location 3:142798-142820
Sequence CACATTTAGCACACAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949100809_949100812 9 Left 949100809 3:142798-142820 CCAAGATCTGTGTGCTAAATGTG No data
Right 949100812 3:142830-142852 ATTGGAGTGTTCCCATTTGCAGG No data
949100809_949100811 -9 Left 949100809 3:142798-142820 CCAAGATCTGTGTGCTAAATGTG No data
Right 949100811 3:142812-142834 CTAAATGTGCTTATTGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949100809 Original CRISPR CACATTTAGCACACAGATCT TGG (reversed) Intergenic
No off target data available for this crispr