ID: 949102047

View in Genome Browser
Species Human (GRCh38)
Location 3:157346-157368
Sequence GAGCTGTAGCTACACAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949102043_949102047 25 Left 949102043 3:157298-157320 CCCAATTTAACTGTGAGCTTGAC No data
Right 949102047 3:157346-157368 GAGCTGTAGCTACACAAAGATGG No data
949102044_949102047 24 Left 949102044 3:157299-157321 CCAATTTAACTGTGAGCTTGACT No data
Right 949102047 3:157346-157368 GAGCTGTAGCTACACAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949102047 Original CRISPR GAGCTGTAGCTACACAAAGA TGG Intergenic
No off target data available for this crispr