ID: 949102541

View in Genome Browser
Species Human (GRCh38)
Location 3:163459-163481
Sequence AAGGAGAAGAAGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949102541_949102552 18 Left 949102541 3:163459-163481 CCCTCCTCCATCTTCTTCTCCTT No data
Right 949102552 3:163500-163522 AGGGTGTTGCTCTGTTGCCGAGG No data
949102541_949102553 22 Left 949102541 3:163459-163481 CCCTCCTCCATCTTCTTCTCCTT No data
Right 949102553 3:163504-163526 TGTTGCTCTGTTGCCGAGGCTGG No data
949102541_949102546 -2 Left 949102541 3:163459-163481 CCCTCCTCCATCTTCTTCTCCTT No data
Right 949102546 3:163480-163502 TTCTCCTTCTTCTTCCTCCCAGG No data
949102541_949102547 -1 Left 949102541 3:163459-163481 CCCTCCTCCATCTTCTTCTCCTT No data
Right 949102547 3:163481-163503 TCTCCTTCTTCTTCCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949102541 Original CRISPR AAGGAGAAGAAGATGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr