ID: 949102547

View in Genome Browser
Species Human (GRCh38)
Location 3:163481-163503
Sequence TCTCCTTCTTCTTCCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949102544_949102547 -8 Left 949102544 3:163466-163488 CCATCTTCTTCTCCTTCTCCTTC 0: 33
1: 704
2: 1415
3: 3852
4: 12834
Right 949102547 3:163481-163503 TCTCCTTCTTCTTCCTCCCAGGG No data
949102542_949102547 -2 Left 949102542 3:163460-163482 CCTCCTCCATCTTCTTCTCCTTC No data
Right 949102547 3:163481-163503 TCTCCTTCTTCTTCCTCCCAGGG No data
949102539_949102547 5 Left 949102539 3:163453-163475 CCTCCTCCCTCCTCCATCTTCTT No data
Right 949102547 3:163481-163503 TCTCCTTCTTCTTCCTCCCAGGG No data
949102540_949102547 2 Left 949102540 3:163456-163478 CCTCCCTCCTCCATCTTCTTCTC No data
Right 949102547 3:163481-163503 TCTCCTTCTTCTTCCTCCCAGGG No data
949102538_949102547 16 Left 949102538 3:163442-163464 CCATCATATCTCCTCCTCCCTCC No data
Right 949102547 3:163481-163503 TCTCCTTCTTCTTCCTCCCAGGG No data
949102543_949102547 -5 Left 949102543 3:163463-163485 CCTCCATCTTCTTCTCCTTCTCC No data
Right 949102547 3:163481-163503 TCTCCTTCTTCTTCCTCCCAGGG No data
949102541_949102547 -1 Left 949102541 3:163459-163481 CCCTCCTCCATCTTCTTCTCCTT No data
Right 949102547 3:163481-163503 TCTCCTTCTTCTTCCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949102547 Original CRISPR TCTCCTTCTTCTTCCTCCCA GGG Intergenic
No off target data available for this crispr