ID: 949106763

View in Genome Browser
Species Human (GRCh38)
Location 3:208797-208819
Sequence CTGGAGACCTTGAATTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949106759_949106763 6 Left 949106759 3:208768-208790 CCCATGTCCAAAAGTATTAAAAA 0: 1
1: 0
2: 4
3: 70
4: 887
Right 949106763 3:208797-208819 CTGGAGACCTTGAATTATACAGG 0: 1
1: 0
2: 0
3: 14
4: 99
949106760_949106763 5 Left 949106760 3:208769-208791 CCATGTCCAAAAGTATTAAAAAA 0: 1
1: 0
2: 0
3: 82
4: 1355
Right 949106763 3:208797-208819 CTGGAGACCTTGAATTATACAGG 0: 1
1: 0
2: 0
3: 14
4: 99
949106761_949106763 -1 Left 949106761 3:208775-208797 CCAAAAGTATTAAAAAATAAAAC 0: 1
1: 1
2: 18
3: 309
4: 2406
Right 949106763 3:208797-208819 CTGGAGACCTTGAATTATACAGG 0: 1
1: 0
2: 0
3: 14
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949106763 Original CRISPR CTGGAGACCTTGAATTATAC AGG Intronic
902849457 1:19142107-19142129 CAGGAGACCTTGGATAAGACAGG + Intronic
904790825 1:33019343-33019365 CTGGAGACCTTTGATTCTATGGG - Intronic
904962732 1:34347629-34347651 CTGGAGACACTGACTTACACGGG - Intergenic
909802913 1:79835691-79835713 CTGGAAATCTTAAATTATAGTGG - Intergenic
920491869 1:206422264-206422286 CTGGGGAACTTGGATGATACAGG + Intronic
920851388 1:209630465-209630487 CAGGAGAGCTTGAATTGTAATGG + Intronic
920968744 1:210723994-210724016 CTGGTAACCTTGAATGACACAGG - Intronic
923647207 1:235835686-235835708 CTGGACACCTAGAATGATACAGG - Intronic
923752943 1:236763528-236763550 CTGGAGAGCTAGAAGGATACTGG - Exonic
923809897 1:237302530-237302552 CTGGTGTCCCTGAATTATACAGG + Intronic
1064257875 10:13759767-13759789 CTGGAGACCTTGAACTTTGTAGG - Intronic
1064411590 10:15109719-15109741 CTGGACACCTCCAATTGTACAGG + Exonic
1065506134 10:26431912-26431934 CTGGCGATCATGAATTATAGTGG - Intergenic
1065786496 10:29220497-29220519 CTGAGGACCTTGAATGAGACCGG - Intergenic
1078092792 11:8277761-8277783 CTGGAGACCTGGAGTGATCCTGG + Intergenic
1089193930 11:116680201-116680223 CTGGAGGCCTTGAAATATTTGGG - Intergenic
1090422662 11:126586204-126586226 CTGAGGACCTTGAATTAGAGCGG + Intronic
1096882917 12:54687179-54687201 CTAGAGACCATGAAGTATCCAGG - Intergenic
1101761988 12:107666295-107666317 CTAGAAACCTTGACTCATACAGG - Intergenic
1110671834 13:78189656-78189678 CTGGAGCCCTTGCATGACACAGG + Intergenic
1111266568 13:85822848-85822870 CTGGAGAACTTGAATGATCTTGG + Intergenic
1112565400 13:100547703-100547725 CTGGAGACATTCAATAAAACAGG + Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113006281 13:105706205-105706227 CTGTAGACCTTGCTTTATTCCGG + Intergenic
1117767520 14:59098344-59098366 TTGAAGACCTTGAATTATAGAGG - Intergenic
1118093436 14:62509077-62509099 CTGAAGAACTTGAATTAAAGTGG + Intergenic
1122013830 14:98776459-98776481 CTGGATTCCTTGAATAATGCAGG - Intergenic
1124037801 15:26072290-26072312 CTGGGGTCCTTGGATCATACTGG - Intergenic
1126701681 15:51373479-51373501 CAGTTGACCTTGAATGATACAGG - Intronic
1128683199 15:69666220-69666242 GTGGGGACCTCGAATGATACTGG + Intergenic
1131629689 15:94163378-94163400 CAGGAGGCTTTGAATTATAGTGG + Intergenic
1135394752 16:22122715-22122737 TTGGAGACCTTAAAATATACTGG - Intronic
1137999806 16:53265138-53265160 CTGAAGTGCTGGAATTATACAGG - Intronic
1139161864 16:64519827-64519849 CTGGAATCCTTGAATAACACTGG + Intergenic
1144778490 17:17796498-17796520 CTGGAGACCTTGAATGTGGCGGG - Exonic
1146754140 17:35411529-35411551 CTTGCGACCTTAAATCATACTGG + Exonic
1149692003 17:58585341-58585363 CTGGAAACCTTGAATTCCAGGGG - Intronic
1153434789 18:5057875-5057897 CTGGAGACCTTGAAATCCAGAGG + Intergenic
1157549535 18:48571801-48571823 CTGGAGACCCTGACTAATCCAGG - Intronic
1158110313 18:53933394-53933416 CTGGAGACCCTGAGTAATACAGG - Intergenic
1167843613 19:52141686-52141708 CTGGGGACCTAGAATTGTGCAGG - Intergenic
927220153 2:20699549-20699571 GTGGAGAGCTTGAATTTTGCTGG + Intronic
928118309 2:28563802-28563824 CTGGAGACCCTGTATTCTACTGG - Intronic
929384958 2:41395602-41395624 CTGGAAACCTATAATTATAGTGG + Intergenic
935821097 2:106893634-106893656 TTGGAGACCTAGAAATATACTGG - Intergenic
944709037 2:202319318-202319340 CTGGTGACCCTGAATAATAAGGG - Intergenic
945101166 2:206263417-206263439 CTGAAGATCTTGAATTACAATGG - Intergenic
945148318 2:206762074-206762096 CTGGTGACCATGAATTTTAAAGG - Intronic
1170223758 20:13967937-13967959 TTAGAGACCTTGAAATATCCAGG - Intronic
1174216933 20:48922578-48922600 CTGAAGACCTTGTATTTTAGTGG - Intronic
1177681490 21:24377109-24377131 ATGAACACCTTTAATTATACTGG - Intergenic
949106763 3:208797-208819 CTGGAGACCTTGAATTATACAGG + Intronic
949898096 3:8785259-8785281 CTGCAGACTCTGAATTATGCAGG - Intronic
949916279 3:8967000-8967022 CTGCAGACCTTGACTTGGACTGG - Intergenic
950176777 3:10880604-10880626 CTGGAGACCTGAAAGTATCCTGG - Intronic
952474906 3:33698335-33698357 CTAGAGACCTTTAATTATATGGG - Intronic
952556358 3:34535562-34535584 CAGTAGAGCTTGAATTACACTGG + Intergenic
959270321 3:104199908-104199930 CTAGAGAACTTGAATTGTAATGG - Intergenic
959536441 3:107491224-107491246 CTAGAGACCTTGTATTATTCAGG - Intergenic
960162803 3:114368675-114368697 CTGGAGGCCTTGGACTCTACTGG - Intronic
964851068 3:161096837-161096859 CTGGAGAACTTGAAAAATACTGG + Intronic
970054145 4:11951824-11951846 TTACAGACCTTGAATTATTCAGG + Intergenic
972350966 4:38235965-38235987 CTGGAGAACCTGACTAATACAGG - Intergenic
972956566 4:44399605-44399627 TTGGATACCCTGAATTATGCTGG - Intronic
973192651 4:47403330-47403352 CTGATGACATTGAATTTTACTGG + Exonic
976447818 4:85151835-85151857 TTGGAGACCTTGCATTCAACTGG + Intergenic
976907106 4:90252145-90252167 TTGGAATTCTTGAATTATACAGG + Intronic
977797910 4:101191031-101191053 CTGAAGACCTTGCCTTAAACAGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
984614765 4:181884184-181884206 CAGGAGACCTTGAACTAACCAGG - Intergenic
984775464 4:183478036-183478058 CTGGAGCCTGTGAATTAAACTGG - Intergenic
985154837 4:186976134-186976156 CAGGTGACCTTGAATAACACAGG + Intergenic
989013204 5:36897865-36897887 CTGGAAAGCTTGAGTCATACAGG + Intronic
989159399 5:38375905-38375927 TTGGTGACCTTGAATAATAATGG + Intronic
990864300 5:60363878-60363900 CTGAAGCTCTTGAATTACACGGG - Intronic
991607296 5:68415727-68415749 CTGGAGATCTTGAGTCTTACAGG - Intergenic
993441806 5:87965979-87966001 CTGGAAACCTTGAATAAGAATGG - Intergenic
993803763 5:92377972-92377994 CTGCACACCTTCAATTTTACAGG - Intergenic
994057030 5:95428629-95428651 CTGGAGACATTCACTTATTCAGG + Exonic
996364035 5:122680835-122680857 CTTGAGACATTTAAGTATACAGG + Intergenic
1001753085 5:174146391-174146413 CTGGAGCCCTGGAATCAGACAGG - Intronic
1007561057 6:42808745-42808767 CTGGATACCTTAAAGAATACTGG + Intronic
1007602745 6:43093348-43093370 ATGGAGACTTTGAATTAGCCGGG - Intronic
1007645867 6:43380504-43380526 CTGGAAACCCTGACTGATACAGG - Intergenic
1010285398 6:74071785-74071807 TTGGAGACCTTGAATAATGTGGG - Intergenic
1010904197 6:81466125-81466147 CTGGAAATCTTGAATTTTATTGG - Intergenic
1012367919 6:98464847-98464869 CTGGTGATCCTGAATAATACTGG - Intergenic
1012954099 6:105549618-105549640 CTTGAGACCCTGATTCATACAGG - Intergenic
1014255597 6:119157729-119157751 CTGAAGACATTGAAATTTACTGG + Intergenic
1015708798 6:136117173-136117195 CTGGAGACATTAAAATATAGAGG + Intronic
1021841241 7:24723367-24723389 CTGGTGACCTTGAACTGTTCTGG - Intronic
1029506111 7:100965079-100965101 CTGAAGACCTCGGATTATTCAGG + Intronic
1031071764 7:117169750-117169772 ATGGAGACCATGAATTTTAGAGG - Intronic
1034159547 7:148982960-148982982 CTGGGGACCTTGAGCTATTCTGG - Intergenic
1035872859 8:3154485-3154507 CTAGAGACCTTATATTTTACTGG + Intronic
1037002573 8:13737859-13737881 CTGGGGACTTTGAAGTATCCAGG - Intergenic
1038410172 8:27352297-27352319 CTGGAGACTATGAATTCTATAGG - Intronic
1039244693 8:35595914-35595936 CTGGGGACCTTGAATCATGCAGG + Intronic
1042027646 8:64440939-64440961 GTGGAGACCTTTAATTTTACTGG - Intergenic
1043802848 8:84632666-84632688 GTGGTGACCTTGACTTATTCCGG + Intronic
1046768170 8:118092611-118092633 CTGGACCCCTAAAATTATACAGG + Intronic
1050632178 9:7571804-7571826 CCGGAAACCTTCTATTATACAGG - Intergenic
1050678782 9:8085905-8085927 CCAGAGCCCTTGAATTATACAGG + Intergenic
1052389292 9:27859615-27859637 TTTAAGACCTTGAATTATACTGG + Intergenic
1052843285 9:33312024-33312046 TAGGAGACCTTGTATTATAATGG - Intronic
1055413464 9:76056576-76056598 CTTTAGACCTTTAATTATAGTGG + Intronic
1055840501 9:80497389-80497411 CTGGAGACCATCAATTTTCCTGG + Intergenic
1056056478 9:82829063-82829085 GTGGAGACCTTGAACTTCACAGG + Intergenic
1186220516 X:7344650-7344672 CTGGAGCGCTTGAATTACTCAGG + Intronic
1191937505 X:66441121-66441143 CTGAAGATTTTGAAGTATACGGG - Intergenic
1195450328 X:105004447-105004469 CTTGAGTCCTTGCAATATACAGG + Intronic
1197440938 X:126489261-126489283 CTGGAGAGCTTAAAACATACTGG + Intergenic
1197571025 X:128150809-128150831 CTGGAGTCCTTGAATTTTGAAGG - Intergenic
1198437972 X:136635935-136635957 CTGGGGACTTTGAGCTATACCGG - Intergenic