ID: 949109047

View in Genome Browser
Species Human (GRCh38)
Location 3:236421-236443
Sequence GTGTTCTTGAGAATGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949109040_949109047 15 Left 949109040 3:236383-236405 CCAGGTCCTTCTAGGTCAGCCTT 0: 1
1: 0
2: 0
3: 17
4: 166
Right 949109047 3:236421-236443 GTGTTCTTGAGAATGTGTCTTGG 0: 1
1: 0
2: 2
3: 21
4: 244
949109039_949109047 16 Left 949109039 3:236382-236404 CCCAGGTCCTTCTAGGTCAGCCT 0: 1
1: 0
2: 1
3: 17
4: 188
Right 949109047 3:236421-236443 GTGTTCTTGAGAATGTGTCTTGG 0: 1
1: 0
2: 2
3: 21
4: 244
949109038_949109047 17 Left 949109038 3:236381-236403 CCCCAGGTCCTTCTAGGTCAGCC 0: 1
1: 0
2: 2
3: 17
4: 165
Right 949109047 3:236421-236443 GTGTTCTTGAGAATGTGTCTTGG 0: 1
1: 0
2: 2
3: 21
4: 244
949109046_949109047 -4 Left 949109046 3:236402-236424 CCTTCTATAGGGAAGGGAAGTGT 0: 1
1: 0
2: 0
3: 15
4: 158
Right 949109047 3:236421-236443 GTGTTCTTGAGAATGTGTCTTGG 0: 1
1: 0
2: 2
3: 21
4: 244
949109041_949109047 9 Left 949109041 3:236389-236411 CCTTCTAGGTCAGCCTTCTATAG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 949109047 3:236421-236443 GTGTTCTTGAGAATGTGTCTTGG 0: 1
1: 0
2: 2
3: 21
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949109047 Original CRISPR GTGTTCTTGAGAATGTGTCT TGG Intronic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
902909322 1:19583575-19583597 TTGTTGTTGAGACAGTGTCTTGG + Intergenic
903153760 1:21430488-21430510 GAGCTCTTGAGTATGTGTTTCGG - Intergenic
905347199 1:37319212-37319234 GTGTGCGTGTGTATGTGTCTGGG + Intergenic
905526396 1:38643297-38643319 GTGTTCTTGAGAAGGTCTCTTGG + Intergenic
906633061 1:47388701-47388723 GTGTGTCTGAGAATGTGTATTGG - Intergenic
907091672 1:51730501-51730523 TTGTTTTTGAGTATGTGTGTCGG + Intronic
907845206 1:58199092-58199114 TTGTTTTTGAGACTGAGTCTTGG - Intronic
908439881 1:64142826-64142848 GACTTCTTGAGAACGTGTTTTGG - Intronic
910456661 1:87404717-87404739 GTGTTTTTGAGAAAGTGGCTGGG - Intergenic
912529024 1:110306754-110306776 GTGTTCTTGGGAATGAGTTTTGG + Intergenic
913060312 1:115198427-115198449 GTGTGCTTGAGAATATTGCTAGG - Intergenic
913143982 1:115971101-115971123 GTTTTCTTGAGATGGAGTCTCGG - Intergenic
913153168 1:116065899-116065921 GTTTTCCTGAGAATATGTTTTGG + Intronic
913373953 1:118130864-118130886 GTGTTCTTGGGAAAGAATCTTGG - Intronic
914081427 1:144414314-144414336 TTTTGCTTGAGAAGGTGTCTCGG + Intergenic
914176337 1:145282851-145282873 TTTTGCTTGAGAAGGTGTCTCGG + Intergenic
914531064 1:148524337-148524359 TTTTGCTTGAGAAGGTGTCTCGG + Intergenic
916295760 1:163217648-163217670 GTGTTCCTTAGAATTTGTTTTGG + Intronic
916844745 1:168638275-168638297 GTTCTCTTGAGAATTTGTCCTGG + Intergenic
920656309 1:207877968-207877990 GGGATCTTGAGAATATGTCATGG - Intergenic
920939933 1:210472686-210472708 GACCTCTTGAGACTGTGTCTTGG - Intronic
921093177 1:211862787-211862809 GTTTTTTTGAGAAGGAGTCTCGG + Intergenic
921863726 1:220066366-220066388 ATGTTATTGAGAAAGTCTCTGGG - Intronic
1065540617 10:26762944-26762966 GTGTTGGTGAGGATGTGTGTTGG - Intronic
1068137771 10:52967256-52967278 GAGCTCTTGAGACTGTGCCTTGG - Intergenic
1069523335 10:69144080-69144102 GAGCTCTTGAGTATGTATCTAGG - Intronic
1073099341 10:100998776-100998798 GTGCACTTGAGACTGTGACTGGG + Intronic
1073795314 10:106981114-106981136 GTGTTATAGAAAATGTGTTTAGG + Intronic
1076139335 10:128067205-128067227 GTGTGCATGTGAATGTGTGTGGG - Intronic
1077964670 11:7116405-7116427 TTGTTCTTGAGAAGGTGTATCGG + Intergenic
1078395829 11:10981081-10981103 GTATTCTTGAGAATGGGGCAGGG + Intergenic
1079691133 11:23418432-23418454 GTGTGCATGTGAATGTGTCCTGG - Intergenic
1080171687 11:29311170-29311192 GTGACCTTGAGAATCTGGCTAGG + Intergenic
1084579551 11:70014604-70014626 GTGGTCTTGTGAAGGTCTCTTGG + Intergenic
1085614015 11:77980688-77980710 GTGCTTTTAAAAATGTGTCTTGG + Intronic
1085851730 11:80128472-80128494 TTGTTCTTGACAATCTTTCTTGG - Intergenic
1086188877 11:84054290-84054312 GTGTTCTTGCGAAAGTCACTAGG + Intronic
1086247595 11:84772633-84772655 GTGGTCTTGAGAGTTCGTCTTGG - Intronic
1086751900 11:90506982-90507004 GTGTTCTTGAGACTGTATCCTGG - Intergenic
1088926610 11:114309100-114309122 GTGTTCTGGGGGATGTGTTTCGG - Intronic
1089714285 11:120341715-120341737 CTATTCTTGAAAATGTGTCATGG - Intronic
1090927512 11:131261345-131261367 GTGTTCTTGTGAGTGTGGCAAGG + Intergenic
1091855817 12:3738743-3738765 GGATTCTTGAATATGTGTCTTGG - Intronic
1096376797 12:51118987-51119009 GTGTTAAAGAGAATGTTTCTAGG + Intronic
1097647178 12:62250390-62250412 ATGTTCATGAGAATGGGTCAAGG + Intronic
1101566812 12:105913829-105913851 GTCTTCTTGGGAAAGTGACTTGG + Intergenic
1102328673 12:112011322-112011344 GTGTATGTGTGAATGTGTCTGGG - Intronic
1104181887 12:126389771-126389793 TTGTTCTTAAAAACGTGTCTGGG + Intergenic
1105222188 13:18341536-18341558 GCGTTCTGGAAAATGTTTCTAGG + Intergenic
1107014821 13:35699765-35699787 GAGTTCTTGAGTAGGTGTTTTGG - Intergenic
1110492029 13:76120683-76120705 GTGTTTTTGAGAGATTGTCTTGG - Intergenic
1111173823 13:84565913-84565935 GTGTTCATGTGGATGTGGCTAGG - Intergenic
1113045857 13:106153856-106153878 GTATTATTGAGAATATGTTTTGG + Intergenic
1113321604 13:109237786-109237808 GTCTTTTTGAGAATGTCTTTGGG - Intergenic
1113863696 13:113507870-113507892 GATTTCAGGAGAATGTGTCTTGG + Intronic
1117015886 14:51516209-51516231 GTTTTTTTGTGAGTGTGTCTTGG - Intronic
1117379968 14:55152046-55152068 ATGTTCTTAAGACTGTGTCCGGG - Intronic
1119668927 14:76504230-76504252 GTGGTCTTGAGAATGGGGCCGGG + Intergenic
1119694333 14:76700837-76700859 GTGTTCTTGAGAATTGGACTTGG - Intergenic
1120954841 14:90072760-90072782 GAATTCTTGAGAAAGTGTATAGG - Intronic
1122697936 14:103566405-103566427 TTCTTTTTGAGAATGAGTCTTGG - Intronic
1124162567 15:27286439-27286461 GACTTCTTGAGACTGTGACTTGG + Intronic
1124200549 15:27675179-27675201 GTGCTCTTGCGCATGTGCCTAGG - Intergenic
1124921449 15:34030639-34030661 GTTTTGTTGAGAAAGAGTCTCGG + Intronic
1127367628 15:58306313-58306335 GTGGCCTTGTGGATGTGTCTAGG - Intronic
1127718812 15:61679509-61679531 TTGTTTTTGAGATTTTGTCTAGG + Intergenic
1127887923 15:63219838-63219860 GTGTTTTTGAGAGGGTCTCTTGG + Intronic
1129229679 15:74190023-74190045 GTATACTGGAGAATGTGTGTAGG + Intronic
1129573804 15:76718942-76718964 CTGTTGTTGAGAGTGTGGCTTGG + Intronic
1129783092 15:78287633-78287655 GTGTTCTTGATACTATGACTCGG - Intronic
1130574060 15:85074869-85074891 GCCTCCTGGAGAATGTGTCTAGG - Intronic
1131464424 15:92644241-92644263 TGGTTATTGGGAATGTGTCTTGG - Intronic
1134308534 16:13055519-13055541 GTGATCATGAGAAAGTGTCTTGG + Intronic
1135212585 16:20536412-20536434 GTGGTATTTATAATGTGTCTGGG + Exonic
1136673976 16:31882426-31882448 GTGCTATTGATAATGGGTCTAGG + Intronic
1137933693 16:52612782-52612804 GGGATCTGGAGACTGTGTCTTGG + Intergenic
1138149084 16:54638440-54638462 GTGTTCTTGGTAAAGTGTGTGGG - Intergenic
1140635512 16:76908354-76908376 GTTTTCTTGAGACAGGGTCTTGG - Intergenic
1142980853 17:3670534-3670556 GTATTTTTTAGAATATGTCTAGG + Exonic
1143115517 17:4579885-4579907 GTGTACCTGAGGATGCGTCTGGG - Intergenic
1143446646 17:7013868-7013890 GCTTTCTTGAGAATGTGGTTAGG + Intronic
1144043534 17:11434074-11434096 TTTTTTTTGAGACTGTGTCTCGG + Intronic
1144441312 17:15285231-15285253 GTGTACTGGAGGATGTGTATAGG + Intergenic
1147560061 17:41503170-41503192 GTGTTCTGGAGAGTGTTTCCAGG + Intronic
1147631736 17:41936583-41936605 GTGTGCCTGAGAAGGGGTCTTGG + Intronic
1148228361 17:45915394-45915416 GTGTGCATGAGCATGTGTGTGGG + Intronic
1148392037 17:47279749-47279771 GTCTTCTTCAGCATCTGTCTTGG + Intronic
1151436567 17:74101165-74101187 CCGTACTTGAGAATGTGTGTTGG - Intergenic
1151497146 17:74465252-74465274 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497156 17:74465638-74465660 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497161 17:74465754-74465776 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497163 17:74465804-74465826 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497165 17:74465858-74465880 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497167 17:74465906-74465928 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1156300248 18:35830202-35830224 GACCTCTTGAGACTGTGTCTTGG - Intergenic
1156543858 18:37944470-37944492 GTGTTCTTTAACATGTGCCTTGG + Intergenic
1157425095 18:47577950-47577972 GTGTTCTGGAGAGTGAGTATTGG + Intergenic
1157612891 18:48969370-48969392 GTGATCTTGAGAAAGTCACTTGG + Intergenic
1159366985 18:67479227-67479249 TTGTTCTTGAGATTTTTTCTGGG - Intergenic
1159861972 18:73660230-73660252 GTGGTCTTGAGAATGTACTTTGG + Intergenic
1162777941 19:12990777-12990799 GTGTGCCTGAGAGTGTGTCTGGG - Intergenic
1163710530 19:18844077-18844099 GAGTTCTGGAGCATGTCTCTGGG + Intronic
1167569799 19:50280038-50280060 CTGAACTGGAGAATGTGTCTGGG + Exonic
1168104599 19:54158999-54159021 GTGTTTGTGTGTATGTGTCTAGG + Intronic
925806193 2:7651260-7651282 TTTATCTTGAGTATGTGTCTGGG + Intergenic
926234952 2:11033812-11033834 GTGTTCTTGAGTATATAACTAGG - Intergenic
927539769 2:23898578-23898600 GACCTCTTGAGACTGTGTCTTGG + Intronic
929808166 2:45166146-45166168 GTGTTTTTGAGAAAAAGTCTTGG - Intergenic
933518345 2:83334912-83334934 GTGAACTTGAGAATGTGTATGGG + Intergenic
934181740 2:89629258-89629280 GCGTTCTGGAAAATGTTTCTAGG - Intergenic
934523106 2:95032315-95032337 CTTCTCTGGAGAATGTGTCTGGG - Intronic
935577418 2:104725276-104725298 ATGTTCTTGGGAATGTAACTTGG - Intergenic
935751803 2:106241990-106242012 GTGGTCTCTGGAATGTGTCTAGG - Intergenic
935912219 2:107909539-107909561 GTGGTCTCTGGAATGTGTCTAGG - Intergenic
936151126 2:110023030-110023052 ATGTTCTTGGGTCTGTGTCTTGG + Intergenic
936193549 2:110348339-110348361 ATGTTCTTGGGTCTGTGTCTTGG - Intergenic
936464256 2:112733147-112733169 GTTTTCTCATGAATGTGTCTGGG - Intronic
938063061 2:128267187-128267209 GAGCTCTTGAGTATGTGTTTCGG + Exonic
938211995 2:129475431-129475453 GTGTTTCTAGGAATGTGTCTAGG - Intergenic
938603908 2:132872746-132872768 GTGTTTTTGAAAATGTGCTTTGG + Intronic
940895615 2:159079980-159080002 GTCTACTTGAAAATGTTTCTGGG + Intronic
942913016 2:181269130-181269152 GTGTCTATGAGAATGTTTCTGGG - Intergenic
944329345 2:198446857-198446879 AAGTTCCTGAGGATGTGTCTGGG - Intronic
944362477 2:198874024-198874046 GTTTTCTTGTGAATATGACTTGG - Intergenic
945632828 2:212304097-212304119 TTGTTGTGGAGAATGTGACTTGG + Intronic
945850284 2:214998072-214998094 TTGTGTTTGAGTATGTGTCTGGG + Intronic
945935052 2:215895382-215895404 CTTTTCTTGAGAATGTGCCGTGG - Intergenic
947153792 2:227140161-227140183 GTGTTCCTGAAAAGGGGTCTCGG - Exonic
947969458 2:234310264-234310286 GTGTCCTTTAGAGTGTGCCTGGG - Intergenic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
1169994362 20:11540623-11540645 GGCTTCTTGAGAACGTGTTTAGG - Intergenic
1171061765 20:21971341-21971363 GTGTTCTTGAGGTTGTCTCATGG - Intergenic
1172780605 20:37434821-37434843 TAGTTCTTGAGTATGTGTGTGGG + Intergenic
1173037123 20:39422962-39422984 ATGATCTTGTGTATGTGTCTGGG + Intergenic
1174714766 20:52746044-52746066 ATGTTTATGAGTATGTGTCTAGG + Intergenic
1176730737 21:10493959-10493981 GCGTTCTGGAAAATGTTTCTAGG + Intergenic
1177018568 21:15822654-15822676 GTGTTCTTTCTGATGTGTCTGGG + Intronic
1178760258 21:35395483-35395505 TTTTTTTTGAGAAGGTGTCTTGG + Intronic
1182081902 22:27535349-27535371 CAGTTCTTGAAAATGTGTGTAGG - Intergenic
1182799460 22:33019668-33019690 TTGTTTTTGAGACTGGGTCTAGG + Intronic
949109047 3:236421-236443 GTGTTCTTGAGAATGTGTCTTGG + Intronic
949155552 3:822703-822725 CTGTTCTTGAGAAAATGCCTAGG + Intergenic
949980224 3:9498094-9498116 GTGTTCTTGAGGATGTAGCCAGG + Intergenic
950363160 3:12464082-12464104 ATGTTCTTGAGAAAATATCTTGG - Intergenic
952069920 3:29622401-29622423 GTGTTGTTGAGAGTGTGCATGGG + Intronic
952232165 3:31443542-31443564 GTGTTATAGAGAATCTGTGTTGG - Intergenic
956562547 3:70596347-70596369 CTGTTCCTGAGATTGTGTGTGGG + Intergenic
956573334 3:70722022-70722044 GTGTTCTGGTGGATGTATCTAGG - Intergenic
957159576 3:76592378-76592400 TTGTTTTTGAGCATCTGTCTAGG - Intronic
957594603 3:82246385-82246407 GTATTCTGGAGAATGTGCATAGG - Intergenic
957766038 3:84625171-84625193 GTGTTCTTGTCAAAGTGTCTAGG - Intergenic
959609873 3:108281150-108281172 GTTTTCTTGAGAATGTCTCTAGG + Intergenic
960722032 3:120633976-120633998 CTGTTCTTCAGAATGTCTTTTGG + Intronic
960904246 3:122583582-122583604 ATATTCTTGAGATTGTATCTGGG + Intronic
961388903 3:126540715-126540737 GTTCTCTTGAGAATATGCCTAGG + Intronic
962410657 3:135139157-135139179 GTGGTGATGAGAATGTGTCCTGG + Intronic
962607727 3:137046207-137046229 TTGTTTTTGAGAAAGGGTCTTGG - Intergenic
963265553 3:143236879-143236901 GTGTTCGTGTGTATGTGTGTGGG + Intergenic
964452783 3:156827517-156827539 GTTTCCTTGAGAATGTGTAATGG + Intronic
964455750 3:156863965-156863987 GAGTTCTTCACAATGTTTCTAGG - Intronic
965541109 3:169871975-169871997 TTTTTCTTGAAAATATGTCTGGG + Intergenic
965670382 3:171141833-171141855 GTCTTGTTGAGAATGTGACAAGG - Intronic
965892909 3:173537123-173537145 GTGTCTTTGAGAGTGTTTCTGGG - Intronic
966509888 3:180750098-180750120 GTGTTGAGGAGAATGTGTATGGG - Intronic
966923946 3:184632359-184632381 GTGTGCTTAAGAGTGTGTGTGGG - Intronic
966960849 3:184937094-184937116 GTGCTGTTTAGAATGTTTCTTGG + Intronic
967505434 3:190247760-190247782 ATCTTCTTGAGAATGTTTCTAGG + Intergenic
968337557 3:197926294-197926316 GTGTTATTGAAAATGTGACGTGG - Intronic
969514666 4:7639939-7639961 GTGTTTGTGAGAATGAGTGTGGG + Intronic
971238443 4:24865172-24865194 CTTTTCTTGAGAAAGTGCCTAGG - Intronic
971804262 4:31335333-31335355 GGCTTCTTGAGACTGTGCCTTGG - Intergenic
972599213 4:40556950-40556972 GTGAGCCTGAGAATGTGTGTTGG + Intronic
972760038 4:42093858-42093880 GTATACTTGAGGATGTGTGTAGG - Intergenic
974304148 4:60109876-60109898 GTGTTCTGGAGAATGTATGTAGG + Intergenic
978364379 4:107965594-107965616 GTGTTCATGAGAATTTATATTGG + Intergenic
979173693 4:117635370-117635392 GAATTCTTAAAAATGTGTCTTGG + Intergenic
980771014 4:137373231-137373253 GTGTTATTGAGAACATGTTTTGG + Intergenic
981092411 4:140745212-140745234 GACCTCTTGAGAATGTGCCTTGG + Intronic
981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG + Intronic
981900376 4:149855094-149855116 CTTTTCTTAAAAATGTGTCTTGG + Intergenic
982928031 4:161364645-161364667 GTTTTGCTGAGAATGTTTCTTGG - Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
986999649 5:13647256-13647278 GTGTTCTTGAGGGTGTTTCTGGG - Intergenic
987506254 5:18776814-18776836 GTGTTTTTGAGAAAGGGCCTGGG - Intergenic
988445871 5:31285217-31285239 GAGGTCTTGAGTATGTGCCTGGG - Intronic
989159476 5:38376698-38376720 GTTTTCTTGAGACAGGGTCTTGG + Intronic
989707645 5:44356791-44356813 GTGTCCATGAAAAGGTGTCTAGG + Intronic
990965241 5:61439692-61439714 GTGTTCTTGATTATTTGTCTTGG + Intronic
992764062 5:79978576-79978598 GTTTTCTTGAGACGGAGTCTTGG - Intronic
993491855 5:88561481-88561503 GTGATTTTCAGAATGTGTTTTGG + Intergenic
995075223 5:107975552-107975574 GTGTTTTTTAAAATGTGTTTTGG + Intronic
995102513 5:108330531-108330553 GTGTTCTTTAAAATATATCTTGG - Intronic
995263991 5:110137529-110137551 GGGTTGGTGAGTATGTGTCTTGG + Intergenic
995803455 5:116025003-116025025 GTGTGCTTGAGAGTATGTCTAGG - Intronic
997559572 5:134834613-134834635 TTGCTCCTGAAAATGTGTCTGGG + Intronic
997710574 5:136000786-136000808 GTGGTCTTTGGAATGAGTCTGGG - Intergenic
998032552 5:138884028-138884050 ATGTTCTTGAGACTGTGCCTTGG - Intronic
998695853 5:144638519-144638541 TTATTCTTGAGAAAGTGTTTGGG - Intergenic
999216082 5:149936432-149936454 GAGTTCCTGAGCACGTGTCTAGG + Intronic
999747835 5:154605762-154605784 GTGATCTTGCAAATGTGTCAAGG - Intergenic
1001975302 5:175993895-175993917 TTCTTCTTAACAATGTGTCTTGG + Intronic
1002242131 5:177849875-177849897 TTCTTCTTAACAATGTGTCTTGG - Intergenic
1006408939 6:33860906-33860928 CTGGTCTTCAGAAGGTGTCTAGG - Intergenic
1007081260 6:39106512-39106534 TTGTTTTTGAGACAGTGTCTTGG - Intronic
1009878163 6:69532297-69532319 GTGTTCATGTGTATGTGTCTTGG + Intergenic
1013268332 6:108521846-108521868 GGGTTCTGGAGAATGTGCCTGGG - Intronic
1013430872 6:110053854-110053876 GTGTTCATGGAAATGTGTTTGGG - Intergenic
1014338410 6:120169797-120169819 ATGGCCTTGAGAATGTTTCTAGG - Intergenic
1015506687 6:133995520-133995542 GTGATCTGGAACATGTGTCTAGG + Intronic
1015762541 6:136680618-136680640 CTGCTCTTGAGAATGTGAATTGG - Intronic
1015878526 6:137847762-137847784 GTGGCCTTTAGAATGTGTCTGGG + Intergenic
1017817600 6:158026985-158027007 GGTTTCCTGAGGATGTGTCTGGG + Intronic
1018462668 6:164013781-164013803 CTGTTCTTGGAAATGTATCTTGG + Intergenic
1021074556 7:16286223-16286245 GTGTTTCTGAGAAGGTGTTTTGG + Intronic
1023410056 7:39881334-39881356 GACTTCCTGAGACTGTGTCTTGG + Intergenic
1024992023 7:55242370-55242392 GTGTACATCACAATGTGTCTGGG + Intronic
1026356613 7:69563336-69563358 GTGTTCTGGCGAAAATGTCTTGG - Intergenic
1026791886 7:73338478-73338500 GTTTTCTTGGGTATGTGCCTAGG + Intronic
1027654893 7:80918711-80918733 GTGTTCTTAAGAAAATGTCCAGG + Intronic
1028362512 7:89986069-89986091 GACTTCTTGAGACTGTGTCATGG + Intergenic
1028432650 7:90765270-90765292 TTGTTCTTGAGAAAGTTTCATGG + Intronic
1032026178 7:128444356-128444378 GTGTACCTGAGACTGTGTGTTGG - Intergenic
1032344805 7:131107817-131107839 GTATTCTTGAGAATTTCCCTGGG + Intergenic
1032827580 7:135587148-135587170 ATGTTCTTCAGAGTGTGTTTGGG + Intronic
1035494646 7:159313345-159313367 GTGTTCAAGAGCATGTGTCAGGG - Intergenic
1035893054 8:3366957-3366979 CTGTTAGTGAGAATGTGTGTGGG - Intronic
1037120120 8:15274091-15274113 GTGTTATTTAGAATGTGTTCTGG - Intergenic
1037952603 8:23028688-23028710 GTGTCCCTGAGAAGGTGTCAGGG + Intronic
1038036075 8:23688015-23688037 GTGTGTTTGAAAATGTATCTGGG + Intergenic
1038650789 8:29401368-29401390 TTGTTTTTGAGACAGTGTCTCGG - Intergenic
1039105656 8:33986375-33986397 GTGTCCTTGAGTATGTGACCTGG + Intergenic
1041067460 8:54095872-54095894 GTATTCTTGACAAAGTGTCAAGG + Intronic
1041102050 8:54406084-54406106 CTGTTCTTGAGAATATGCCTAGG - Intergenic
1043195156 8:77283612-77283634 GTGTGTTTGAGAATGTATCAGGG + Intergenic
1043753596 8:83972263-83972285 GTGTTCTTCAGGTTTTGTCTGGG + Intergenic
1044266604 8:90189229-90189251 AAGTTCTTGAAAATGTGCCTGGG - Intergenic
1044356423 8:91227963-91227985 GTGGCCTTGAGAATGTCCCTAGG + Intronic
1044805072 8:95998414-95998436 GTGTCCTGGAGACTGTCTCTGGG - Intergenic
1045827794 8:106421200-106421222 GTGTTCTATAGAATGTGTGTGGG - Intronic
1048388106 8:133932474-133932496 GTATTCTTGAGACCGTGTTTTGG - Intergenic
1049535995 8:143182588-143182610 GTGTGCATGTGAGTGTGTCTGGG + Intergenic
1049938736 9:524528-524550 TTGTTTTTGAAACTGTGTCTTGG + Intronic
1051052611 9:12950499-12950521 GTGTGCTGGAGATTGTGGCTGGG - Intergenic
1051054737 9:12971415-12971437 GTGTTCTTAAGAATTTCACTAGG - Intergenic
1051676066 9:19559668-19559690 GTGTTCTATGGAATGTTTCTGGG - Intronic
1052105078 9:24504522-24504544 ATGTTCTGGATAATGTGTCTTGG + Intergenic
1056377684 9:86030268-86030290 ATGTTCTTGAGCATGTTTCACGG - Intronic
1056953503 9:91064599-91064621 GTGTTCTTGAGCATTTATCCCGG + Intergenic
1057567598 9:96179011-96179033 GTGTTCTTGATGTTCTGTCTCGG - Intergenic
1059944592 9:119396191-119396213 GTGTACTGGAGGATGTGTGTAGG - Intergenic
1060298908 9:122362435-122362457 GTGCTGTTGACAATGTGTGTAGG - Intergenic
1060492964 9:124098414-124098436 GTGTGTTTGAGCACGTGTCTGGG + Intergenic
1060506466 9:124201694-124201716 GTTTTTTTGACAATGTCTCTTGG - Intergenic
1187076225 X:15938154-15938176 GAGGTTATGAGAATGTGTCTTGG + Intergenic
1187253246 X:17618654-17618676 ATGTTCTTGAGAATATGGCCAGG + Intronic
1187480708 X:19652537-19652559 GTGTTTTGGAGATTGTGTCAGGG - Intronic
1187725053 X:22193741-22193763 ATATTCTTGTGAATGTCTCTTGG + Intronic
1187795277 X:22997081-22997103 GTGTTCTTTGGAATGTATTTTGG - Intergenic
1189746050 X:44169990-44170012 TTCTTCTTGTGAATGGGTCTGGG + Intronic
1193277066 X:79602054-79602076 GGGTTCTTGAGTATGTTTGTGGG - Intergenic
1194070575 X:89320695-89320717 GTGGTTTTGAGAGTTTGTCTTGG + Intergenic
1194567260 X:95506100-95506122 GTGTGCCTGAGACTGTGCCTTGG - Intergenic
1195106719 X:101610161-101610183 AATTTCTTGAGAATATGTCTAGG + Intergenic
1197253720 X:124240860-124240882 GTGTCCATGAGAATGTCTTTAGG - Intronic
1199696479 X:150346141-150346163 GTGGTTTTGAAAATGTCTCTGGG - Intergenic
1199798834 X:151229627-151229649 GGGGTCTTGAGAAGGTGCCTGGG + Intergenic
1200724816 Y:6656434-6656456 GTGGTTTTGAGAGTTTGTCTTGG + Intergenic