ID: 949109063

View in Genome Browser
Species Human (GRCh38)
Location 3:236643-236665
Sequence AACCTTGGCCTGTTACAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949109063_949109065 8 Left 949109063 3:236643-236665 CCAAGTTGTAACAGGCCAAGGTT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 949109065 3:236674-236696 CATTATACTGACATTTTCTGTGG 0: 1
1: 0
2: 1
3: 34
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949109063 Original CRISPR AACCTTGGCCTGTTACAACT TGG (reversed) Intronic
903108972 1:21111966-21111988 ATCTTTGGCCTGTGACAATTGGG - Intronic
907746169 1:57215833-57215855 AAGCTTGGCCTTTTCCAAATAGG - Intronic
908015912 1:59835909-59835931 GTCCATGGCCTGTTAAAACTGGG - Intronic
908488696 1:64621267-64621289 AACCTTTCCCTGGTACCACTGGG + Intronic
910968905 1:92834385-92834407 AATCCTGGGCTTTTACAACTAGG + Intronic
921407221 1:214793549-214793571 GACCTTGGGCTGATACTACTTGG + Intergenic
1075861333 10:125679312-125679334 AAACTTGGGCTGTTGCTACTGGG - Intronic
1079503698 11:21131107-21131129 AACTTTTGCCTCTTGCAACTAGG + Intronic
1081608059 11:44539806-44539828 AACCTTTGCCTTTTCCAACTTGG + Intergenic
1085167741 11:74418245-74418267 AAATTTGGCCAGTTCCAACTTGG - Intergenic
1086551771 11:88060752-88060774 AAATTTTGGCTGTTACAACTGGG - Intergenic
1093466727 12:19457003-19457025 AACCAAGGCATGTTAAAACTTGG + Intronic
1093920874 12:24857831-24857853 AACCTTGGTGTGTAATAACTAGG + Intronic
1100001468 12:89841959-89841981 AATTTTGTCCTGTTAAAACTGGG - Intergenic
1100979438 12:100153352-100153374 CACCTTGGCCTGTTGCTCCTAGG + Intergenic
1101965166 12:109277401-109277423 ATCCTTTGCCTGTTATATCTTGG + Intergenic
1103373840 12:120439823-120439845 ATCCTTGGCCTGTACCCACTAGG + Intronic
1105638542 13:22239701-22239723 GAACTTTTCCTGTTACAACTGGG - Intergenic
1115364267 14:32539404-32539426 TACTTTGGCCTGATACAATTTGG - Intronic
1115457327 14:33618610-33618632 AACCGTGGCCTGTTAGGAATCGG - Intronic
1116397755 14:44467456-44467478 AACTTTAACCTGTTACATCTTGG + Intergenic
1117285545 14:54282833-54282855 AGCCTTGGCCTATTGCAACCTGG - Intergenic
1126744460 15:51812127-51812149 AACCTGGGCCTGCAGCAACTTGG - Exonic
1129403733 15:75300984-75301006 CACCTTGGCCTGTTGCTCCTAGG - Intergenic
1129727482 15:77909015-77909037 CACCTTGGCCTGTTGCTCCTAGG + Intergenic
1129821388 15:78604393-78604415 AACCTTGGCCATTCAGAACTTGG + Intronic
1129840396 15:78739958-78739980 CACCTTGGCCTGTTGCTCCTAGG - Intergenic
1130258503 15:82337035-82337057 CACCTTGGCCTGTTGCTCCTAGG + Intergenic
1130270169 15:82442034-82442056 CACCTTGGCCTGTTGCTTCTAGG - Intergenic
1130275797 15:82475798-82475820 GACCTTGGCCTGTTGCTCCTAGG + Intergenic
1130462510 15:84169355-84169377 CACCTTGGCCTGTTGCTTCTAGG - Intergenic
1130468156 15:84203190-84203212 GACCTTGGCCTGTTGCTCCTAGG + Intergenic
1130485582 15:84396547-84396569 CACCTTGGCCTGTTGCTTCTAGG - Intergenic
1130490167 15:84425438-84425460 CACCTTGGCCTGTTGCTTCTAGG + Intergenic
1130496108 15:84470352-84470374 GACCTTGGCCTGTTGCTCCTAGG - Intergenic
1130501754 15:84504188-84504210 CACCTTGGCCTGTTGCTTCTAGG + Intergenic
1130590449 15:85207788-85207810 GACCTTGGCCTGTTGCTCCTAGG + Intergenic
1130596423 15:85252925-85252947 CACCTTGGCCTGTTGCTCCTAGG - Intergenic
1130928325 15:88401708-88401730 AACATGGGCCTGTTACATTTAGG - Intergenic
1132071075 15:98777048-98777070 AGCCTTGGCCTGTAATCACTGGG + Intronic
1133457324 16:5953994-5954016 CACCTTGGCTTGTCACCACTGGG + Intergenic
1133901217 16:9976875-9976897 AGCCTTTGCCTGGTACGACTTGG - Intronic
1140791118 16:78392104-78392126 AGCCGTGGCCTGTTATAAATTGG + Intronic
1142119659 16:88379685-88379707 CACTTTGGACTGTTACAACTGGG - Intergenic
1149319717 17:55470870-55470892 ACCACTGGCCTGTTACAACATGG + Intergenic
1156603033 18:38632875-38632897 AACCTTGTCTTTTAACAACTTGG + Intergenic
1159035484 18:63273679-63273701 AACCATGACCGGTTAGAACTGGG - Intronic
1159240642 18:65739129-65739151 AACCTTGTCCTATTATAACAAGG + Intergenic
1161800916 19:6416374-6416396 CACCTGGGCCTGGTCCAACTGGG + Exonic
1163999923 19:21089058-21089080 AACTTTGGCATGTAATAACTGGG - Intronic
1164006092 19:21150783-21150805 AAACTTGGCATGTAATAACTAGG - Intronic
1168382260 19:55933774-55933796 CACCTTGGCCTCCTAAAACTAGG - Intergenic
930142770 2:47969660-47969682 ATCCTTTGACTGTTTCAACTGGG + Intergenic
931314321 2:61113104-61113126 TACCTTGGCATGTTAAAAATCGG + Intronic
933334690 2:80942628-80942650 TACCTTAGCCTGTTACAGTTGGG + Intergenic
936951255 2:117979711-117979733 AACCTTGGTCTGCTACACTTTGG - Intronic
938736955 2:134194443-134194465 AACCTTGGACAGTTACAAGGGGG + Intronic
940126612 2:150332852-150332874 CACCTTTGCCTGTTACACATGGG + Intergenic
1173905123 20:46621990-46622012 AACCTTTGCAGGTTACAATTTGG - Intronic
1179532830 21:42031896-42031918 AACCTGGCCCAGTTACAAATGGG + Intergenic
1182635554 22:31723891-31723913 ATCCTTGGTCTGTTAGAAATCGG + Intronic
1184044857 22:41966692-41966714 AAACTTGGCCTGTAATTACTGGG + Intergenic
1184175937 22:42788714-42788736 CACCTTGGCCTGTTGCTCCTAGG - Intergenic
949109063 3:236643-236665 AACCTTGGCCTGTTACAACTTGG - Intronic
951043717 3:18015510-18015532 AACCTTTGCCTGTTATCACAAGG - Intronic
955590956 3:60534473-60534495 AACTCTGCCATGTTACAACTGGG - Intronic
959118084 3:102200935-102200957 GACCTTGGCCTGCTCCACCTTGG + Intronic
960580578 3:119275199-119275221 AATCTTGGCCTTTTACGAATTGG - Intergenic
961718851 3:128878866-128878888 AACCTTGGGCGGTTACAGCCTGG + Intergenic
963781942 3:149495250-149495272 AACCAAGGCATGTTACTACTTGG - Intronic
967147539 3:186618651-186618673 GACCTTGGGGTGTTACCACTCGG + Intronic
974250577 4:59378296-59378318 AAACTTTTCCTGTTTCAACTGGG - Intergenic
978031618 4:103944167-103944189 ATCATTGGCCTGTTACAGCATGG + Intergenic
978111046 4:104964270-104964292 AAACTTGGGCTGTTACTGCTGGG - Intergenic
978272825 4:106911991-106912013 AAACTTGGCCTCTTTCAGCTAGG + Intergenic
979120954 4:116900577-116900599 AACATATGCCTGTGACAACTTGG + Intergenic
983461089 4:168026797-168026819 CACCTTGGCCTTTTACAACAGGG - Intergenic
988866387 5:35339602-35339624 AACCTTGGTGTGTTGAAACTGGG - Intergenic
994641273 5:102412311-102412333 GACCATGGCCTGTGACACCTTGG - Intronic
995409371 5:111837373-111837395 AAGCTTGGATTTTTACAACTTGG - Intronic
999114937 5:149154398-149154420 AGCCTGGGCCTGTTACATGTAGG + Intronic
999124460 5:149236763-149236785 AAACTTGGGCTCTTGCAACTTGG + Intronic
1001845446 5:174917561-174917583 CACCTTGGCCTGTTGCTCCTAGG + Intergenic
1007066930 6:39000409-39000431 GTCCGTGGCCTGTTAAAACTGGG + Intronic
1012395975 6:98797614-98797636 AACCTTGGACATTTACAAGTTGG + Intergenic
1016120576 6:140337801-140337823 CACCTTGGCCTTTTACAATAGGG - Intergenic
1020187854 7:5972378-5972400 AACCTTGTCCTGTTTGAACTTGG - Intergenic
1020295063 7:6752392-6752414 AACCTTGTCCTGTTTGAACTTGG + Intergenic
1034206639 7:149321847-149321869 AAGCTTGATCTGTTACCACTGGG - Intergenic
1043447831 8:80336563-80336585 AACTTTGGGTTGTCACAACTGGG - Intergenic
1044016367 8:87052192-87052214 CACCTTGGTCTTTTACAACAGGG - Intronic
1048240159 8:132733353-132733375 AACGTAGGCCTGTTATAACAGGG + Intronic
1048723582 8:137356896-137356918 AACATGGACCTGTGACAACTGGG + Intergenic
1055583874 9:77735788-77735810 AGCCCTGGCCTGTCACCACTGGG - Intronic
1056755704 9:89380754-89380776 AACCTAAGCCTGTTATAAATGGG - Intronic
1061061698 9:128253866-128253888 CACCTTGGCCTGTTGCTCCTAGG + Intronic
1061164491 9:128914408-128914430 AACCTGTGCCTTTTACAAATGGG + Intronic
1186573535 X:10741150-10741172 AACCTTGGACTATTAAAGCTAGG + Intronic
1193814780 X:86091397-86091419 ACCCTGGGCAGGTTACAACTGGG + Intergenic
1195047865 X:101070298-101070320 AACCTATGCTTGTTACTACTGGG - Intergenic
1196882537 X:120211785-120211807 AACCAAGGCATGTTACCACTTGG + Intergenic
1198813493 X:140560958-140560980 GACCTTGGCCTGGGACAAATTGG + Intergenic
1198870605 X:141174584-141174606 AACCATGGGCTGTTACTCCTGGG - Intergenic
1202368062 Y:24180136-24180158 CACCTTGGCCTGTTGCTTCTAGG - Intergenic
1202372632 Y:24209046-24209068 CACCTTGGCCTGTTGCTTCTAGG + Intergenic
1202498152 Y:25461074-25461096 CACCTTGGCCTGTTGCTTCTAGG - Intergenic
1202502723 Y:25489981-25490003 CACCTTGGCCTGTTGCTTCTAGG + Intergenic