ID: 949110527

View in Genome Browser
Species Human (GRCh38)
Location 3:255012-255034
Sequence TTGTAGCTAGAGATGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949110527_949110530 -6 Left 949110527 3:255012-255034 CCTATCTCCATCTCTAGCTACAA 0: 1
1: 0
2: 1
3: 32
4: 284
Right 949110530 3:255029-255051 CTACAATTGTTCTGAATTTTGGG 0: 1
1: 0
2: 0
3: 17
4: 257
949110527_949110529 -7 Left 949110527 3:255012-255034 CCTATCTCCATCTCTAGCTACAA 0: 1
1: 0
2: 1
3: 32
4: 284
Right 949110529 3:255028-255050 GCTACAATTGTTCTGAATTTTGG 0: 1
1: 0
2: 3
3: 24
4: 194
949110527_949110531 -5 Left 949110527 3:255012-255034 CCTATCTCCATCTCTAGCTACAA 0: 1
1: 0
2: 1
3: 32
4: 284
Right 949110531 3:255030-255052 TACAATTGTTCTGAATTTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949110527 Original CRISPR TTGTAGCTAGAGATGGAGAT AGG (reversed) Intronic
903304429 1:22402636-22402658 TTGTGGCATGAGATGGAAATTGG + Intergenic
904835056 1:33330328-33330350 TAGTAGTTAGTGATGGAGTTAGG - Intronic
906057528 1:42928624-42928646 TTGAGGCTACAGATGAAGATTGG + Intronic
906459730 1:46028077-46028099 TTGTAGCTAGATGTTAAGATTGG + Intronic
908449829 1:64241937-64241959 TTGCTGCCAAAGATGGAGATAGG + Intronic
909058524 1:70851403-70851425 GTGGAGCTAGAGGTAGAGATAGG + Intergenic
909151526 1:72011920-72011942 TTGAAGGTGGAGATGGAGAGTGG + Intronic
909462051 1:75927935-75927957 TAATAGCTAGAGAGTGAGATAGG - Intronic
910242500 1:85102733-85102755 TTGTATCTAGAGATACAAATTGG - Intronic
910491419 1:87776582-87776604 ATGTAGCTAGAGATGAGGAAGGG - Intergenic
911304981 1:96222691-96222713 ATGTAGCCAGGGATGGAGGTAGG - Intergenic
911471201 1:98320340-98320362 TTGAAGCTATAGATCGAGTTGGG - Intergenic
911934752 1:103955101-103955123 TTGAATCTAGAGATTGAGTTGGG + Intergenic
911964760 1:104352374-104352396 ATTGGGCTAGAGATGGAGATGGG + Intergenic
914360418 1:146931054-146931076 TTGTAGCTTGAGAAGGAGCTGGG + Intergenic
914493329 1:148168844-148168866 TTGTAGCTTGAGAAGGAGCTGGG - Intergenic
914963093 1:152224294-152224316 GTGGAGATAGAGGTGGAGATGGG - Intergenic
915255655 1:154626995-154627017 TTGTTGCTAGAGAGGGAGGCAGG - Intronic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
916598670 1:166271457-166271479 TGGAAGCTGGAGGTGGAGATTGG - Intergenic
916908790 1:169321179-169321201 ATTTTGCTAGAGATGGAGTTTGG - Intronic
919934461 1:202242383-202242405 TCGTAGCTAGTGATAGAGCTAGG - Intronic
921042964 1:211451633-211451655 TTGGAGCTAAAGAGAGAGATAGG + Intergenic
921045936 1:211478233-211478255 GTGTAGCTAGGGGTGGAGGTAGG - Exonic
922035537 1:221844504-221844526 ATGTGGTTAGGGATGGAGATGGG - Intergenic
923736643 1:236615518-236615540 TTGGAGCAAGTGATGGAGTTTGG + Intergenic
924399705 1:243665925-243665947 TAGTTGCTAATGATGGAGATAGG - Intronic
924813509 1:247423630-247423652 TGGTAGCTACACATAGAGATGGG + Intronic
1064722571 10:18244910-18244932 TTGGAGTCAGAGAGGGAGATAGG + Intronic
1067807358 10:49402330-49402352 TTCTGGCTAGGGAAGGAGATGGG + Intergenic
1067854468 10:49780318-49780340 TTCTGGCTAGGGAAGGAGATGGG + Intergenic
1067992670 10:51232860-51232882 TCATAGCTAGAAATGGAAATGGG - Intronic
1068798750 10:61115047-61115069 CTGTAGATTGAGGTGGAGATAGG + Intergenic
1069635304 10:69921415-69921437 TTATAGCTAGAGGCGGAGAAGGG + Intronic
1071209407 10:83320632-83320654 TTATAGCTAAAGAGAGAGATAGG + Intergenic
1072275228 10:93816230-93816252 TTGTGGCTAGAAGTGGAAATGGG + Intergenic
1073519305 10:104111675-104111697 TTGAAGCCAGGGATGGAGATAGG - Intergenic
1074003149 10:109392500-109392522 TCCTAGCTATAGCTGGAGATGGG - Intergenic
1074226656 10:111490986-111491008 TTGTAGCTAAAGAGAGAGATAGG - Intergenic
1076012047 10:126996765-126996787 TGGTGGTTAGAGATGAAGATGGG + Exonic
1080010313 11:27452527-27452549 TGGTTGCTAGGGTTGGAGATAGG - Intronic
1081446868 11:43139191-43139213 TTTAAGCTAGAGAGGGAGATAGG - Intergenic
1081776208 11:45677625-45677647 TTGAAGCCAGAGGTGGAGAGTGG + Intergenic
1082953952 11:58848753-58848775 GAGAAGGTAGAGATGGAGATGGG + Intronic
1083543772 11:63534132-63534154 TTGCAGCAAGAGAGAGAGATGGG + Intergenic
1084343892 11:68529862-68529884 TTGTAGCTGTGGAAGGAGATGGG + Intronic
1084825027 11:71723485-71723507 TTCAAGCTAGAGAGGGAGAAAGG + Intergenic
1085253210 11:75157094-75157116 ATGAAGATGGAGATGGAGATGGG + Intronic
1085542545 11:77286069-77286091 AAGAAGCTAGAGAGGGAGATGGG - Intronic
1087922294 11:103880159-103880181 TTGTGGCTATATTTGGAGATTGG - Intergenic
1088311502 11:108465653-108465675 GTGTAGCTAGAGAGTGAGAATGG + Intronic
1089317380 11:117601162-117601184 TTGGAGCTAGAGGTGGGGGTGGG - Intronic
1090284936 11:125491662-125491684 TTGTAGGTAGAGATGGAGAATGG - Intronic
1090517878 11:127448140-127448162 GTGTGGCTAGAGAAGGAAATTGG - Intergenic
1090748061 11:129723078-129723100 TTTTTTCTAGAGAGGGAGATGGG + Intergenic
1091522295 12:1258152-1258174 ATGTAGCTAGAGATTAAGATAGG - Intronic
1092001786 12:5038799-5038821 TTATACCTAGAGAGGGAGAGAGG + Intergenic
1092213867 12:6667005-6667027 TTGTAGGCAGAGAAGGAGAGAGG + Exonic
1094260125 12:28485782-28485804 TTGTAGGTACATATGGAAATAGG - Intronic
1095490374 12:42727169-42727191 ATGTAGATAGAGATGTACATGGG - Intergenic
1098112936 12:67142995-67143017 TTATAGCTAAACATGGATATAGG + Intergenic
1098522471 12:71449111-71449133 TTGAAGCGAGGGATGGAGAAAGG - Intronic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099359245 12:81678631-81678653 TTGTAGCTAGAATGGGAGAGGGG - Intronic
1100523763 12:95401004-95401026 TCATAGATAGATATGGAGATAGG - Intergenic
1100744008 12:97625684-97625706 TTGTGCCAAGAGATGGAGAGAGG + Intergenic
1100840974 12:98611500-98611522 CTGTAGATAGAGATGGAGACAGG - Intergenic
1101802012 12:108030693-108030715 TAGAAGCAAGAGATGGAGATGGG + Intergenic
1102030807 12:109739102-109739124 TTGGAGGTAGAGGAGGAGATGGG + Intronic
1104715788 12:131015378-131015400 TTGGAGATTGAGATGGACATGGG + Intronic
1104715821 12:131015552-131015574 TTGGAGATGGAGATGGAGATGGG + Intronic
1104715835 12:131015618-131015640 ATGGAGTTGGAGATGGAGATGGG + Intronic
1105386380 13:19933533-19933555 TTGTTGCCTGAGATAGAGATTGG + Intergenic
1105558791 13:21471342-21471364 TTTTTGGTAGAGACGGAGATGGG + Intergenic
1106140951 13:27011140-27011162 TTGTAGCTGGATTTGGAGGTGGG + Intergenic
1107383986 13:39888536-39888558 ATGTGGCTAGTGATGGAGAGAGG - Intergenic
1107418738 13:40225501-40225523 TAGTAGCTGGAGGTGGAGGTGGG + Intergenic
1108058560 13:46509670-46509692 ATGGAGCAAGAGAGGGAGATGGG - Intergenic
1108129375 13:47280844-47280866 TTGCAGCAGGAGATAGAGATAGG - Intergenic
1108291485 13:48966218-48966240 TTGTAGCCAGGGAGAGAGATTGG + Intergenic
1109277949 13:60322863-60322885 TTGTAGCTGCAGATGGGGACTGG + Intergenic
1111604177 13:90516650-90516672 TTGTAGCTTGTGATGGTGGTAGG + Intergenic
1111910117 13:94301805-94301827 TTATGGCTGGAGATGGAGATTGG - Intronic
1112154165 13:96799059-96799081 CTGTATTTAGATATGGAGATAGG - Intronic
1114360502 14:21967095-21967117 TTGAGGCTGGAGATGGAGTTAGG - Intergenic
1115123769 14:29969513-29969535 TAGTAACTAGAGGTGGAGATTGG + Intronic
1117168267 14:53062387-53062409 ATGTAACTAGAGATGAAGATAGG + Intronic
1118264973 14:64286210-64286232 TGGTAGCTGGAGAAGGATATAGG + Intronic
1118336946 14:64861562-64861584 AGGTAGCTAGGGATGGAGAAAGG - Intronic
1119083622 14:71720235-71720257 ATGTAGCGAGAGAAGGAGATCGG - Intronic
1120260370 14:82176940-82176962 TTGTACAAAGAGAAGGAGATTGG - Intergenic
1121429314 14:93875689-93875711 TTGTGGGTAGTGATGGAGAAAGG + Intergenic
1121463281 14:94098341-94098363 GTGAAGACAGAGATGGAGATGGG - Intronic
1121524445 14:94609671-94609693 TTGTAGCTAGGTATGGCCATGGG + Intronic
1121533960 14:94678252-94678274 TTGGAGCTAGAGACGCAGACAGG + Intergenic
1122294784 14:100699289-100699311 TTGTCACTAGAGATGGCTATCGG + Intergenic
1124225937 15:27895043-27895065 TTGTAGCTAGACTTAGAGAAAGG + Intronic
1126614280 15:50560834-50560856 TTGTTGCTATAGATACAGATAGG + Exonic
1127771260 15:62232642-62232664 TTGTAGCAAGAGTAGGAGGTGGG + Intergenic
1128479738 15:68026884-68026906 TTGTAGATAGCAATAGAGATGGG + Intergenic
1128736687 15:70057619-70057641 TAGGAGCTGGTGATGGAGATGGG + Exonic
1130939845 15:88498277-88498299 TTGTGGCTAGAGAAGGACACAGG + Intergenic
1130966050 15:88698821-88698843 TTGCAGCTAGAGATTGGGAGAGG - Intergenic
1131889646 15:96958819-96958841 TTGTAGCTGGAGCTGGAGCCAGG + Intergenic
1133206903 16:4239408-4239430 TTGTTGCTTGATACGGAGATTGG - Intronic
1135948297 16:26885779-26885801 CTGCAGCTAGAGATAGAAATAGG + Intergenic
1136093482 16:27937320-27937342 TTGAACCTGGAGATGGAGGTTGG - Intronic
1136093670 16:27938301-27938323 TTGAACCTGGAGATGGAGGTTGG + Intronic
1137238549 16:46635291-46635313 TGGTAGCCAGAGATAGAGAGAGG + Intergenic
1137470166 16:48747179-48747201 TTGTAACTGGAGATAGAGGTGGG + Intergenic
1139694245 16:68662269-68662291 ATGTGGCTAGAGAGAGAGATTGG + Intronic
1139770518 16:69271914-69271936 TTGGTACTAAAGATGGAGATGGG + Intronic
1140998175 16:80281273-80281295 TTGTAGCTGGAAATTGACATTGG + Intergenic
1142999668 17:3784971-3784993 TTTTTGGTAGAGATGGAGTTTGG - Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1146457004 17:33016234-33016256 TTGTTGCAGGAGATGGAGCTAGG + Intronic
1147613055 17:41812743-41812765 TCGCAGCCAGGGATGGAGATGGG + Intronic
1147620389 17:41862835-41862857 TGGGAGCTAGAGATACAGATTGG - Intronic
1148643546 17:49205953-49205975 ATGAGGCTAGAGAGGGAGATTGG - Intronic
1149449016 17:56735032-56735054 TTGAAGCAAGAGATGGAGGTGGG + Intergenic
1150236290 17:63595456-63595478 ATGTAGCTAGAGATGTATACAGG + Intergenic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1152276763 17:79362541-79362563 CTGTGGCTTGGGATGGAGATGGG + Intronic
1155048394 18:22124804-22124826 TTGTAGGTAGTGATGGAAAGGGG + Intergenic
1155661826 18:28258393-28258415 TTGTAGCAAGGGAAGAAGATCGG - Intergenic
1156535355 18:37858926-37858948 TTAAAGCTAAAGAGGGAGATAGG - Intergenic
1157898598 18:51491876-51491898 TTGTAGTTAGAGAGGGAGGCAGG - Intergenic
1158428414 18:57360744-57360766 ATGGTGATAGAGATGGAGATAGG - Exonic
1158701036 18:59747007-59747029 TTGAATCTATAGATGAAGATAGG + Intergenic
1164144369 19:22502409-22502431 TTGGAGCTCAAGATGGAGCTCGG - Intronic
1164483691 19:28636666-28636688 TTGTAGATAGAGATTGAGAGGGG + Intergenic
1165726514 19:38116674-38116696 TTTTTGGTAGAGATGGGGATGGG - Intronic
1167697347 19:51023045-51023067 TTGAAGCTGGGGATGGGGATGGG + Intronic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
927615258 2:24587419-24587441 TTGTAATTAGTGAGGGAGATAGG + Intronic
928700450 2:33893679-33893701 TTGGAGATAGGGATGGAGATGGG - Intergenic
930253684 2:49064641-49064663 TGGTAGCTGGAGAAAGAGATGGG + Intronic
930463720 2:51717215-51717237 TTGTCTCTGGAGATGGACATGGG + Intergenic
930759039 2:55011796-55011818 TTGGAGTTAGAGAGGCAGATAGG - Intronic
931829286 2:66034321-66034343 TTTTTAGTAGAGATGGAGATGGG + Intergenic
932734800 2:74247062-74247084 TTGTAGGTAGTGATGAAGTTTGG + Exonic
933344892 2:81070987-81071009 TTGTTGTTACAGATGCAGATGGG - Intergenic
935260182 2:101348364-101348386 TTAAACCTAGAGATGGAGATGGG + Exonic
936550980 2:113439329-113439351 GTGTAGCTAAAGATGGACAAAGG - Intronic
936558372 2:113515387-113515409 TTTAAGCTAAAGAGGGAGATAGG + Intergenic
937502869 2:122501628-122501650 TTATAGCTAGAAATAGAAATAGG - Intergenic
939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG + Intronic
939930196 2:148224686-148224708 TTAGAGCTAAAGATAGAGATAGG - Intronic
941047727 2:160695453-160695475 GTGGAGATGGAGATGGAGATGGG + Intergenic
941410841 2:165155525-165155547 TTGTAGCTAGGGCTACAGATGGG + Intronic
941549894 2:166901956-166901978 TTTTAGCCAGAGATAGAGCTGGG + Intronic
941771584 2:169350989-169351011 GTGTAGCTAGAGATGAAAACAGG + Intronic
941863600 2:170310583-170310605 TTGAACCTGGAGATGGAGGTTGG + Intronic
944511309 2:200468807-200468829 TTGTAGAGAGAGATGGAAGTTGG - Intronic
945670967 2:212802359-212802381 TCGTAACTAGAGAAGGTGATCGG - Intergenic
945877286 2:215291712-215291734 GTGTAGCTAGAGAGGAAAATAGG - Intergenic
947181408 2:227414695-227414717 CTGTATCTGGAGATAGAGATAGG + Intergenic
1170099691 20:12685394-12685416 TTCTAGCAAGAGATGGAGCAGGG - Intergenic
1170184852 20:13577248-13577270 TTGTAGGTAGAAATGTAAATTGG + Intronic
1170222431 20:13954253-13954275 TTGGGGGTAGAGATGGAGAGAGG + Intronic
1172573528 20:35988670-35988692 TTGCAGCCAGAGACAGAGATTGG + Intronic
1173474691 20:43350686-43350708 TTTTTAGTAGAGATGGAGATGGG - Intergenic
1173850456 20:46214581-46214603 CTGAAGCTAGAGATGGAGTGGGG - Intronic
1174149314 20:48474972-48474994 ATGTTCCTGGAGATGGAGATTGG - Intergenic
1179051881 21:37895507-37895529 AGGTAGCTAGAAATGGGGATGGG - Intronic
1179330004 21:40390694-40390716 GTGAAGATAGAGGTGGAGATTGG - Intronic
1181172521 22:21017771-21017793 TTGTCTCAAGAGATGGACATGGG + Intronic
1181176830 22:21042610-21042632 TTGTCTCAAGAGATGGACATGGG - Intergenic
1181388654 22:22563159-22563181 TTGTGGCTGTATATGGAGATGGG - Intronic
1181517760 22:23425520-23425542 TTATAGCTAGAGATGGCTAAAGG + Intergenic
949110527 3:255012-255034 TTGTAGCTAGAGATGGAGATAGG - Intronic
949826845 3:8174565-8174587 ATGTAGCCAGAGTTGGAGGTGGG - Intergenic
951360090 3:21714703-21714725 TGTTAGCTGGAGATGGATATAGG - Intronic
952557056 3:34544100-34544122 ATGAAGATAGAGATGAAGATTGG - Intergenic
956730179 3:72189299-72189321 GTGTAGTTGGAGATGGAGGTAGG - Intergenic
957132047 3:76235315-76235337 GTGAAGGTAGAGATAGAGATTGG + Intronic
957741361 3:84273896-84273918 TTCTAGCTAAACATGGTGATTGG + Intergenic
957935188 3:86933314-86933336 TAGTAGATTGAGATGGAGCTTGG + Intergenic
959565749 3:107831401-107831423 CTGGGGCTAGAGATGGTGATGGG - Intergenic
960023012 3:112976641-112976663 TTTTAAGTAGAGATGGAGTTTGG - Intergenic
960058898 3:113298392-113298414 TTGGATCTAGAGATGGAGAAAGG + Intronic
960140015 3:114142605-114142627 TTGTTTCTAGGGAGGGAGATGGG + Intronic
961572406 3:127809268-127809290 TTGCAGCTAGAGCTGGCTATAGG - Intronic
962986003 3:140536589-140536611 GTGGGGCTTGAGATGGAGATAGG + Intronic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
963284342 3:143418484-143418506 TTGTAACAGGAGAAGGAGATGGG + Intronic
963432935 3:145232517-145232539 TTTTAAGTAGAGATGGAGATGGG - Intergenic
963470027 3:145728771-145728793 ATGTAGCTACATATAGAGATAGG - Intergenic
965832282 3:172806019-172806041 CTGTTCCTAGAGATGGAGATGGG - Intronic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
966470472 3:180283296-180283318 TAGAAGCCAGAGATAGAGATGGG - Intergenic
966483270 3:180436535-180436557 TTGTAGATAGAAATGGAAAATGG + Intergenic
966914147 3:184575665-184575687 TTGTAGCTGCAGCTGGAGTTAGG + Intronic
968049735 3:195646283-195646305 CTGCAGCTAGAGATGCAGACAGG + Intergenic
968097563 3:195942305-195942327 GTGCAGCTAGAGATGCAGACAGG - Intergenic
968304398 3:197639699-197639721 CTGCAGCTAGAGATGCAGACAGG - Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969942724 4:10750746-10750768 TTGAAGTTAGAGAGGGAGAGGGG + Intergenic
970365144 4:15350512-15350534 TAGTGGCCAGAGATGGAGAGAGG - Intronic
972794327 4:42400225-42400247 TTGTAGAGAGAGAAGGAAATTGG + Intronic
973795802 4:54425154-54425176 TTGTAGCTGGAGATGGTGGTTGG + Intergenic
974374583 4:61060274-61060296 TTGTAGCTGGAGGTAGAAATGGG + Intergenic
974513352 4:62874295-62874317 TTGGAGCTAAAGAGAGAGATAGG + Intergenic
974773270 4:66444134-66444156 TTGTAACTATAGTTGGAGATAGG - Intergenic
974785780 4:66618621-66618643 TTGTGCCTAGAGATGGAACTGGG + Intergenic
975526747 4:75359172-75359194 ATGTTGCTATAGATGGAGAGAGG - Intergenic
975763761 4:77644587-77644609 TTAGAGCTAAAGAGGGAGATAGG + Intergenic
976754867 4:88487381-88487403 TGGTAGCAAGGGATGGAGCTTGG + Intronic
976796609 4:88940792-88940814 TTGTAGCATGAGATGGAAAAGGG + Intronic
976893705 4:90082285-90082307 TGGTAGCTAGAGATGCAGCTTGG - Intergenic
977424321 4:96847264-96847286 TTATAATTGGAGATGGAGATTGG - Intergenic
977483683 4:97613953-97613975 TTGTAGCTGTAGATGAAGCTAGG - Intronic
979099382 4:116596780-116596802 ATGTAACTAGATTTGGAGATGGG + Intergenic
980948510 4:139347703-139347725 TTGCAGATAGTGATGGAGTTAGG - Intronic
981031129 4:140126914-140126936 TAGTGGGTAGAGATGGAGATAGG - Intronic
981312829 4:143313569-143313591 TTGAAGCCAGATAAGGAGATTGG - Intergenic
981870811 4:149483899-149483921 TTGGAGCTAAAGAGAGAGATAGG - Intergenic
981895896 4:149798843-149798865 TTGGAGCTGGAGAGAGAGATGGG + Intergenic
981983852 4:150830024-150830046 TGGTAACTAGAGATGGTGAGAGG - Intronic
982114676 4:152088248-152088270 TTGTAATTAGAGATGTAGAAAGG - Intergenic
985005766 4:185534687-185534709 TTGTAGCTAGAGTTAGAAGTTGG + Intronic
985321207 4:188713410-188713432 TAGGAGAAAGAGATGGAGATGGG - Intergenic
985933141 5:3074739-3074761 TTAGAGATAGAGATAGAGATAGG - Intergenic
987546595 5:19318208-19318230 TTGTAGCTACAGCTGCAGATAGG - Intergenic
988663501 5:33299726-33299748 TTGTAGCTAGAGATGTGGTAAGG + Intergenic
989393867 5:40931371-40931393 TTGGAGCTAGAAATGTATATAGG + Intronic
990033797 5:51294662-51294684 TTGTTGCTATAGATGCAAATTGG + Intergenic
991043896 5:62203110-62203132 TTCTAGCTGCAAATGGAGATTGG - Intergenic
991255682 5:64611544-64611566 TAGTAGCTATTCATGGAGATGGG + Exonic
993398027 5:87414776-87414798 TTGAAACTAGAAATGGAAATAGG - Intergenic
993831311 5:92762270-92762292 TCGTCCCTAGAGATGCAGATTGG - Intergenic
993854369 5:93055164-93055186 TAATAGATAGAGATGGAGAATGG - Intergenic
995797192 5:115954017-115954039 GTGTAACTGGAGATGGAGATTGG + Intergenic
995901110 5:117067279-117067301 TTGTAGCTAGAGGAGGTCATAGG + Intergenic
996147752 5:119996330-119996352 TTGTGGCCAGAAATGGAGGTGGG + Intergenic
996791454 5:127297910-127297932 TTGGGGCTAGAGACGGAGACAGG + Intronic
1001848822 5:174944965-174944987 TTGAAGCTATATTTGGAGATAGG - Intergenic
1004069921 6:12288612-12288634 CTGAAGCAAGAGTTGGAGATGGG - Intergenic
1006164087 6:32054280-32054302 TGGGAGCTAAAGATGGGGATGGG - Intronic
1007290511 6:40782731-40782753 TTGTGCCTAGGGGTGGAGATGGG - Intergenic
1007650467 6:43417267-43417289 GTGTAGCTAGAGCTGGGGCTGGG - Intergenic
1008240872 6:49109913-49109935 TTGGAAGTAGTGATGGAGATGGG - Intergenic
1008286138 6:49653429-49653451 TTGTAGCTAGAGCTGGATTAAGG - Intergenic
1009949077 6:70374891-70374913 TTGGAGGAAGAGATAGAGATAGG + Intergenic
1010551282 6:77225102-77225124 TTATAGCTATAGAGGGAAATGGG - Intergenic
1011549126 6:88513419-88513441 TTGCAGCTAGGGATGGAATTTGG - Intergenic
1011946112 6:92905430-92905452 TCATAGATAGATATGGAGATAGG - Intergenic
1015279026 6:131412612-131412634 TGGTAGCTATATATGGTGATAGG + Intergenic
1016449373 6:144165936-144165958 TCGCAGCTAGAGATGGAAATGGG + Intronic
1017290252 6:152727506-152727528 TTGTAGCTATAGCTTGAGAGTGG + Intergenic
1017506674 6:155074889-155074911 TTGTCAGTAGAGGTGGAGATGGG + Intronic
1017743288 6:157426031-157426053 TTCTACCTAGAGAGGCAGATGGG + Intronic
1018372899 6:163185116-163185138 TTGTAGCCAGGGATGGGGAAAGG + Intronic
1021127989 7:16876268-16876290 ATATAGCCAGAGATAGAGATAGG - Intronic
1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG + Intronic
1023170178 7:37383825-37383847 TTGTTGTTTGAGATGGAGTTTGG + Intronic
1023496497 7:40802911-40802933 TTGTAGCTAGTGATAGAAAATGG - Intronic
1023913495 7:44571436-44571458 TTGAAGATAGAGATGGAAAGGGG - Intronic
1025080260 7:55975539-55975561 TGGTTGCTAGAGATGGGGAGAGG + Intronic
1026849048 7:73713555-73713577 TTGTAGCTTTTGATAGAGATGGG - Intronic
1028440690 7:90856839-90856861 TTGTAGCTTGAGATATAGTTGGG + Intronic
1030752779 7:113251063-113251085 TTGGAGCTAAAGAGAGAGATAGG + Intergenic
1031112944 7:117633081-117633103 TTGAATCTATAGATGGAGTTGGG + Intronic
1031326674 7:120408399-120408421 TTATAGCTAGAGGTAAAGATTGG + Intronic
1031598898 7:123679881-123679903 TTCTGGTTAGAGATGGACATAGG + Intergenic
1033716440 7:144007939-144007961 GTGAAGGTAGAGATAGAGATTGG + Intergenic
1038364611 8:26918448-26918470 TTGAAGATAAAGATGGAGAGTGG - Intergenic
1039492295 8:37956994-37957016 TTGAAGCTAGAGGTGGCGACTGG + Intergenic
1042170855 8:65989599-65989621 TTAGAGCTAGACATGGAGCTGGG + Intergenic
1042918018 8:73894219-73894241 TTGTAGATAGAGATGGGGAGAGG - Intergenic
1043197008 8:77307923-77307945 ATGTAGGTAGAGATGCAGGTTGG + Intergenic
1044394951 8:91700312-91700334 TTGGAGCTAAAGAAAGAGATAGG - Intergenic
1045237609 8:100368221-100368243 TTGTAGCAAGAGATGGAACATGG + Intronic
1046603125 8:116340884-116340906 ATGAAGCTAAAGATGGACATGGG - Intergenic
1049894493 9:100879-100901 TTTAAGCTAAAGAGGGAGATAGG - Intergenic
1049901954 9:177489-177511 GTGTAGCTAAAGATGGACAAAGG + Intronic
1050150225 9:2612604-2612626 TTGTGGATAGAGATGGAGAGGGG - Intergenic
1050566839 9:6893637-6893659 TTGTAGCAAGAGATGGAGGGAGG + Intronic
1052545981 9:29880443-29880465 GTGAAGCAAGAGATTGAGATGGG - Intergenic
1053735703 9:41100869-41100891 TTTAAGCTAAAGAGGGAGATAGG - Intergenic
1053744987 9:41187776-41187798 GTGTAGCTAAAGATGGACAAAGG + Intronic
1054482283 9:65677437-65677459 GTGTAGCTAAAGATGGACAAAGG - Intronic
1054683360 9:68243492-68243514 GTGTAGCTAAAGATGGACAAAGG - Intronic
1054692677 9:68330529-68330551 TTTAAGCTAAAGAGGGAGATAGG + Intronic
1055511892 9:77003298-77003320 GTGTAGCTTGAAATGGAGTTAGG - Intergenic
1056605010 9:88078299-88078321 TTGTAGCAGGAGATGGACATTGG + Intergenic
1057113126 9:92493061-92493083 ATGTAGCTGGAGCTGGAGAAAGG + Intronic
1058358071 9:104106787-104106809 ATGTAGCAAGATATGGTGATGGG + Intronic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1059621989 9:116016150-116016172 CTGTTGGTAGAGATGTAGATTGG - Intergenic
1059889248 9:118783042-118783064 TTGTAGCAGGAGAAAGAGATGGG + Intergenic
1062001996 9:134220843-134220865 TTGTAGCTACAGATGAGAATAGG + Intergenic
1185815350 X:3150037-3150059 GTGAAGATGGAGATGGAGATTGG - Intergenic
1186252902 X:7688230-7688252 TTCTAGTTGGAGGTGGAGATAGG - Intergenic
1186543224 X:10422258-10422280 TTGTAGTTTGTGATGGAGCTGGG + Intergenic
1186899150 X:14034389-14034411 TTGGAGCTAAAGAAAGAGATAGG + Intergenic
1186954064 X:14660622-14660644 TCAAAGCGAGAGATGGAGATTGG + Intronic
1187747586 X:22426441-22426463 TAGCAGGGAGAGATGGAGATGGG + Intergenic
1188259727 X:28008366-28008388 TTTTAGCCAGTGCTGGAGATGGG + Intergenic
1188729339 X:33627530-33627552 CTAGAGCTAGAGATGGAAATAGG + Intergenic
1188750285 X:33896585-33896607 TTGTAGCAAGAGATAAAGAGAGG - Intergenic
1190176196 X:48152225-48152247 TTATTGGTAGAGATGGGGATGGG - Intergenic
1190630192 X:52378734-52378756 TAGTAGCTACAGAAGGACATGGG + Intergenic
1190636113 X:52435693-52435715 TAGTAGCTACAGAAGGACATGGG + Intergenic
1190637959 X:52455113-52455135 TCGTAGCTAGAGAAGGACATGGG + Intergenic
1190639966 X:52474893-52474915 TCGTAGCTACAGAAGGACATGGG + Intergenic
1190643512 X:52503597-52503619 TCGTAGCTATAGAAGGACATGGG + Intergenic
1190647706 X:52537972-52537994 TCGTAGCTACAGAAGGACATGGG - Intergenic
1190678694 X:52805347-52805369 TCATAGCTAGAGAAGGACATGGG - Intergenic
1193185306 X:78504852-78504874 TTATAGCTAAAGAGAGAGATAGG + Intergenic
1194023678 X:88725020-88725042 TAGGAGGTAGAGATAGAGATAGG + Intergenic
1194259093 X:91671693-91671715 TTGTAGCAGGAGATGTGGATAGG - Intergenic
1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG + Intronic
1196740332 X:119019510-119019532 TTCTAGCTACAGGTGGTGATGGG - Intergenic
1196910264 X:120477690-120477712 TTTTTGCTAGTGATGGATATAGG + Intergenic
1197307910 X:124866020-124866042 TTGGAGCTAAAGAGAGAGATAGG + Intronic
1200577791 Y:4910890-4910912 TTGTAGCAGGAGATGTGGATAGG - Intergenic
1201265948 Y:12206689-12206711 GTGAAGATGGAGATGGAGATCGG + Intergenic