ID: 949113396

View in Genome Browser
Species Human (GRCh38)
Location 3:290631-290653
Sequence CCTACTGTACTCTAGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949113396_949113400 28 Left 949113396 3:290631-290653 CCCTGTTCCTAGAGTACAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 949113400 3:290682-290704 CATAAACCCCTTTCCTCATTTGG 0: 1
1: 1
2: 0
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949113396 Original CRISPR CCTACTGTACTCTAGGAACA GGG (reversed) Intronic
906071653 1:43021282-43021304 CTCACTGTGGTCTAGGAACAAGG - Intergenic
908344836 1:63221639-63221661 CCTACTGTATGCTAGGCACTAGG + Intergenic
915168017 1:153959328-153959350 GCTGCTGTACCCTAGGAATATGG - Exonic
916997105 1:170312832-170312854 CCTACTGTTCTCTTGCAACCTGG - Intergenic
919847920 1:201653262-201653284 CCTTCTGTCCTCCAGGAAAAGGG + Intronic
919875813 1:201866936-201866958 ATTACTGTACTTTAGGAAAATGG - Exonic
922346380 1:224699999-224700021 CCTACTGGACTGTAGGAAGGTGG + Intronic
922926045 1:229347377-229347399 CCTTCAGTACTGTATGAACAAGG + Intergenic
1064457203 10:15498805-15498827 CCTGCTGGACTCTAGGCAGAAGG + Intergenic
1067302948 10:45031181-45031203 ACAACTGTACCCTAAGAACATGG - Intergenic
1068223844 10:54080821-54080843 CCTTCTGTACTGTAGGAAGCTGG - Intronic
1071800111 10:89050355-89050377 CCTACTTTATTCAAGGCACAAGG - Intergenic
1072089335 10:92111958-92111980 CCTACTGTACTCTGCCAAGAGGG - Intronic
1072806877 10:98429432-98429454 CGTCCTGTGCTCTAGGAACACGG + Intronic
1073574145 10:104607745-104607767 CCTACTGTGAACTAGGACCATGG + Intergenic
1073676588 10:105654321-105654343 CCAACCTTACTCTGGGAACAGGG - Intergenic
1078709411 11:13776468-13776490 CCTGCTGAACCCTAGGATCAGGG + Intergenic
1079312950 11:19382227-19382249 CCCATTGTACACTGGGAACATGG - Intronic
1079699911 11:23532383-23532405 CCTAGTATACTCTAGGTACCTGG - Intergenic
1081957001 11:47101820-47101842 CCTACTTTAATCTAGGATCACGG - Intronic
1083142395 11:60732759-60732781 CCTACTGCATGCTAGGAACTGGG + Intronic
1086181010 11:83951636-83951658 CCTACTGTGATCAAGTAACAAGG + Intronic
1086449134 11:86899046-86899068 CCAACTTTACCCTATGAACATGG - Intronic
1087165391 11:94998123-94998145 CCTACAGTTCTCAAGGAAAATGG + Exonic
1087168391 11:95026299-95026321 CCTACAGTTCTCAAGGAAAATGG + Exonic
1087852564 11:103049362-103049384 CCTACAATAGTCTAGGAACTTGG - Intergenic
1088096562 11:106107595-106107617 CCTAGTATATTCAAGGAACAGGG - Intergenic
1093666214 12:21816420-21816442 CCTACGGTGCTCTGGGAGCATGG + Intronic
1096976069 12:55699832-55699854 CCTCCTGGACTCTAGGGGCATGG - Intronic
1099844808 12:88016583-88016605 ATTTCTGTACTCTAGGAAAAAGG - Intronic
1101141836 12:101803213-101803235 CTTTTTGTAATCTAGGAACATGG - Intronic
1102050079 12:109855851-109855873 CCTACTGTGAGCCAGGAACATGG + Intronic
1106908730 13:34439501-34439523 TCTAATGTACTCTGGGAACTCGG - Intergenic
1108470504 13:50762431-50762453 CCTGCTGTGCTCACGGAACAGGG + Intronic
1108693439 13:52881166-52881188 CCCACTGTAGCCCAGGAACATGG + Intergenic
1108700686 13:52941503-52941525 TCTGCTGTTCTCTAGGAACCTGG + Intergenic
1111002609 13:82205340-82205362 CCCTCTGTGCTCTTGGAACAAGG + Intergenic
1119145615 14:72311018-72311040 CTTTCTGTATTCTAAGAACAAGG - Intronic
1122671503 14:103376235-103376257 CCCACTGTACTCCAGCGACAGGG + Intergenic
1124953352 15:34343314-34343336 CCTACTGTGTGCTAGGTACACGG + Exonic
1129295103 15:74595933-74595955 CCTGCTGTACTCTGGGGGCAGGG + Exonic
1135305702 16:21365980-21366002 CTTACTGTACTCTAGCAAACTGG - Intergenic
1136302447 16:29345134-29345156 CTTACTGTACTCTAGCAAACTGG - Intergenic
1140656320 16:77143701-77143723 CCAACTCTACCCTAGGCACAAGG + Intergenic
1141551380 16:84808916-84808938 CATCCAGTGCTCTAGGAACAGGG - Intergenic
1142033618 16:87850681-87850703 CCTGCTGGACTCAAGCAACAGGG + Intronic
1146128427 17:30248617-30248639 TCCACTCTACTCTAGGAACAAGG + Exonic
1149210437 17:54294381-54294403 CCTTCTCTACTCTAGGAAGAAGG - Intergenic
1152647491 17:81476227-81476249 CCTGCTGTGCTCCAGGAAGATGG + Intergenic
1155436861 18:25821536-25821558 ACCACTGAAGTCTAGGAACATGG + Intergenic
1158475137 18:57773303-57773325 CTTACTGTCCTCTGGCAACAGGG + Intronic
1162154731 19:8669843-8669865 CCTACTGTATGCCAGGTACATGG - Intergenic
1163525382 19:17817837-17817859 CCTACTGTACGCCAGGCACCTGG + Intronic
1168335857 19:55597486-55597508 CCCACTGTACTCTGGGCAAAAGG - Intronic
926785895 2:16518161-16518183 CCAACTGTAGTGTTGGAACAAGG - Intergenic
927468436 2:23354138-23354160 CCTAGTGTGGTCCAGGAACAGGG + Intergenic
928332301 2:30366989-30367011 CCTACTGTGGTCCAGGCACAAGG - Intergenic
931907789 2:66861464-66861486 CCTACTTTACTCTATCAGCAAGG - Intergenic
934614706 2:95763946-95763968 CCTACTGCCCTCCCGGAACAGGG - Intergenic
934646198 2:96060549-96060571 CCTACTGCCCTCCCGGAACAGGG + Intergenic
934839601 2:97616632-97616654 CCTACTGCCCTCCCGGAACAGGG + Intergenic
935742956 2:106167046-106167068 CCTTCTATACTCTAGGCACCTGG + Intronic
938074308 2:128323596-128323618 CCAACTGTAATCTAGCAAGAGGG - Intergenic
939022052 2:136969673-136969695 CCTAATGTGCCCTGGGAACAGGG - Intronic
940494682 2:154411006-154411028 CCTGCTGCAGTCTTGGAACATGG + Intronic
942185950 2:173425477-173425499 CCTAATGTGCTCAAAGAACAGGG - Intergenic
944338805 2:198570033-198570055 CATAATGTTCTCTAGGCACAGGG - Intronic
948468032 2:238161484-238161506 CCTTCTGTACTCTGGGACCCTGG - Intronic
1170857231 20:20068447-20068469 GATACTGTATTCTAGGAACCTGG + Intronic
1171241362 20:23569672-23569694 CCTGCTGTGATCTGGGAACATGG - Intergenic
1171773556 20:29345840-29345862 CCTTCTGAACTCAGGGAACAAGG + Intergenic
1175363533 20:58433908-58433930 CCAGCTGTACTCTAGGAAGTAGG + Intronic
1176877477 21:14147167-14147189 CCTACTGCATTCTAGGCAGAAGG - Intronic
1181972106 22:26698691-26698713 CCTACTCTCCTCCAGGAACTGGG - Intergenic
949113396 3:290631-290653 CCTACTGTACTCTAGGAACAGGG - Intronic
950390965 3:12696608-12696630 CCTACTGTATGCCAGGCACATGG + Intergenic
953429785 3:42829672-42829694 CCAACTGTGCTATAGGAAGAAGG - Intronic
956847018 3:73193096-73193118 ACTACTGTGCTCAAGGAAGAGGG + Intergenic
957798787 3:85047567-85047589 CATACTGTATGCTAGAAACAAGG + Intronic
958737515 3:98026329-98026351 CCTACAGTTCTCTAGGACGAAGG + Intronic
962652349 3:137509458-137509480 CCTGCGGTACTCTGGGAACCTGG + Intergenic
963161879 3:142159521-142159543 CCTGCATTCCTCTAGGAACAAGG + Intergenic
965574684 3:170206105-170206127 CCTACTGTGTGCTAGGTACAGGG + Intergenic
966932508 3:184685104-184685126 CCAACTGTGCTCCAGGAACAGGG + Intergenic
967366865 3:188696953-188696975 GCTCGTGTACTCTAGAAACAAGG + Intronic
972912380 4:43833427-43833449 CCTACTGCACTCTAGCACCCTGG - Intergenic
972928257 4:44039352-44039374 GCTACTGGACTCTAAGAACTAGG - Intergenic
973948045 4:55980682-55980704 AATACTGTACTCTAGGAAGAGGG + Intronic
975498822 4:75062554-75062576 CCTACTGGTCTCTTGGGACAAGG + Intergenic
978116717 4:105027605-105027627 CCTCCTTTCCTCTAGTAACATGG - Intergenic
980004491 4:127525986-127526008 CCTACTTTTCTTTAGGAACTAGG - Intergenic
981155318 4:141428038-141428060 CCTTCAGTAATCTAGGAACAGGG + Intergenic
984611901 4:181850514-181850536 ACTACTGTACTATAGAAATATGG - Intergenic
987001650 5:13666264-13666286 CTTTCTTTACTCTAGGTACATGG - Intergenic
987851987 5:23366927-23366949 TCTAATTTACTCAAGGAACAAGG + Intergenic
990749393 5:58997077-58997099 ACTTCTCTACTCTAGGAAGACGG + Intronic
990951957 5:61307108-61307130 GCTACTTTACTCTAGGTAGAGGG + Intergenic
993064667 5:83082925-83082947 CCTAGTGTACTTAAGAAACAGGG - Intronic
993182594 5:84573358-84573380 CATAATGTTCTCTAGAAACAAGG - Intergenic
993598089 5:89884736-89884758 CCTTCTGTACTCTAGCTACTGGG - Intergenic
994931670 5:106195646-106195668 CCTTCTGTTTTCTATGAACATGG + Intergenic
995037139 5:107547142-107547164 CCTACTGTACACATGGATCATGG + Intronic
996899196 5:128524123-128524145 CCCACTTTACTCCAGGGACATGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1001601056 5:172928650-172928672 CCTACTATACCCTGGGTACAGGG - Intronic
1001961646 5:175883497-175883519 CCCACTGTACTCTAGCCACAAGG - Exonic
1005416777 6:25608166-25608188 CCTACTGTCCTCTACAAACTAGG - Intronic
1005805686 6:29472298-29472320 CCTTCTGTGCTCTAGGGCCAGGG + Intergenic
1013365417 6:109433982-109434004 CCCACTGGACTCTAGGAAATTGG - Intronic
1013403910 6:109825228-109825250 CCTGATGTACTCTCGGTACATGG - Exonic
1014347142 6:120286534-120286556 CCTACTGTACTGTAAGGCCAAGG - Intergenic
1016530468 6:145053658-145053680 CCTACTGTCCAGTTGGAACATGG + Intergenic
1018219488 6:161564222-161564244 CCTACTGGCCTCTAGGCAGATGG - Intronic
1021559403 7:21954734-21954756 CCTTCTCTTCTCTTGGAACATGG - Intergenic
1023739890 7:43270040-43270062 CTTACTATATTCTAGTAACAGGG - Intronic
1028695368 7:93704577-93704599 CTTTCTGGACACTAGGAACAAGG - Intronic
1029925404 7:104311023-104311045 CCTAGTTTACTCTAGTAACTTGG - Intergenic
1030345269 7:108426321-108426343 ATTACTGTGCTCTAGGCACAAGG + Intronic
1032558415 7:132861999-132862021 CCTACTGTACCTTAAGAAAAAGG + Intronic
1033435849 7:141333057-141333079 GCTGCTGACCTCTAGGAACAAGG - Intronic
1039359136 8:36856655-36856677 GCTAGTGTAGTCTAGGAACTGGG - Intronic
1043202601 8:77389645-77389667 CCTACTGTATGCCAGGAGCAGGG + Intergenic
1044215723 8:89607897-89607919 CCTCCTTTACTCTAGAAATAAGG - Intergenic
1046409711 8:113825270-113825292 CCTACTTTATTCTAGGCACTCGG - Intergenic
1049929558 9:443113-443135 CCTTCTGTACCCTGGGAACTTGG - Intronic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1057230546 9:93319066-93319088 CCCACTTCACTCAAGGAACAGGG - Intronic
1059684922 9:116625814-116625836 CTTACTGAACTCTAGGAAGGAGG + Intronic
1187590184 X:20709027-20709049 CCTAGGGTACTCTAGGAGCTGGG + Intergenic
1190777019 X:53560923-53560945 CCTACTGTATCCTAGGTACTAGG - Intronic
1192079352 X:68032469-68032491 CATCCTGTACACTAGGAAAAGGG + Intergenic
1201250865 Y:12056343-12056365 TCTACTGTGATATAGGAACATGG - Intergenic