ID: 949118270

View in Genome Browser
Species Human (GRCh38)
Location 3:355462-355484
Sequence AGGTTCCAGTGGAAGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949118270_949118276 11 Left 949118270 3:355462-355484 CCCCAAATCTTCCACTGGAACCT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 949118276 3:355496-355518 TATTTTGGATGTCCTTGTTCAGG 0: 1
1: 0
2: 1
3: 17
4: 230
949118270_949118277 18 Left 949118270 3:355462-355484 CCCCAAATCTTCCACTGGAACCT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 949118277 3:355503-355525 GATGTCCTTGTTCAGGAAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 212
949118270_949118274 -4 Left 949118270 3:355462-355484 CCCCAAATCTTCCACTGGAACCT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 949118274 3:355481-355503 ACCTAGAGCTCAGATTATTTTGG 0: 1
1: 0
2: 0
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949118270 Original CRISPR AGGTTCCAGTGGAAGATTTG GGG (reversed) Intronic
900031790 1:377993-378015 GGGTTAAAGTGCAAGATTTGGGG + Intergenic
902398983 1:16147278-16147300 AGGTCCCAATGGGAAATTTGTGG + Intronic
905565220 1:38958965-38958987 AGGTAGCAGTGGAAGAAGTGGGG + Intergenic
906529831 1:46517360-46517382 AGGGAGCAGTGGGAGATTTGAGG - Intergenic
906980424 1:50622927-50622949 AGGTCCTAGAGGAAGATTTGAGG - Intronic
907540721 1:55214330-55214352 AGGTTTCAGTGAAGGATTGGCGG - Intronic
909379338 1:74980109-74980131 AGCTACCAGTGGAAAAGTTGGGG - Intergenic
910121679 1:83797389-83797411 AGGATACAGTGCAAAATTTGGGG + Intergenic
911230108 1:95351993-95352015 ATTTTCCAGTGGCAGATGTGGGG - Intergenic
912737541 1:112163570-112163592 AGGTTCCTGAGAAAGATTTATGG - Intergenic
914474275 1:148010556-148010578 AGGTTACCCTGGAAGATCTGTGG - Intergenic
915492572 1:156259285-156259307 GGGCTCCAGGGGAAGATTTGTGG + Intronic
915568282 1:156728926-156728948 ATGCTGGAGTGGAAGATTTGAGG - Exonic
915971494 1:160358341-160358363 AGGTTCCAGTGACAAATTAGTGG - Exonic
917665776 1:177223904-177223926 AGGTTCAAATGGAAGAATTATGG + Intronic
918170140 1:181988638-181988660 AGGGCACAGTGGAAGGTTTGGGG - Intergenic
918425885 1:184409352-184409374 AGGTACTAATGGAAGGTTTGTGG + Intronic
921867011 1:220096666-220096688 AGATTTCAGTGGAAATTTTGGGG + Intronic
922956592 1:229607046-229607068 AGCTTGCAGTGGGAAATTTGAGG - Intronic
1063105969 10:2992580-2992602 AGGTTCCAGAGGAAGGTATTCGG + Intergenic
1067187424 10:44042894-44042916 AAGTTTCAGTGGCAGCTTTGGGG + Intergenic
1067758265 10:49023421-49023443 ATGTTTCAGTGGAAGGTTTAAGG + Intronic
1067962837 10:50875854-50875876 TGGGTCCAGTGAAGGATTTGGGG - Intronic
1070638066 10:78145120-78145142 ATTTTCCACTGAAAGATTTGTGG - Intergenic
1073739401 10:106389556-106389578 ATGTTTCAGTGTATGATTTGGGG - Intergenic
1073769156 10:106716461-106716483 AGGTTTCAGTGGATAATTTATGG - Intronic
1074471429 10:113730414-113730436 AGGTGCTGGTGGAAGATGTGAGG - Exonic
1077506960 11:2934070-2934092 AGGCTCCAGTGGAAGAGCTCAGG - Intergenic
1079125859 11:17718458-17718480 AGTTTCCAGTTATAGATTTGGGG - Intergenic
1083076516 11:60044635-60044657 AAGTTTCAGTGGAAGATATTTGG - Intronic
1084954508 11:72684286-72684308 TGGGTCCAGCGGAAGACTTGGGG - Intergenic
1085172421 11:74460645-74460667 AGGTTGGAGTGTAAGATGTGTGG + Intronic
1085277582 11:75309928-75309950 AGGAGCAAGTGGAAGGTTTGGGG - Intronic
1086213789 11:84352562-84352584 AGATTCCTGCGGGAGATTTGTGG + Intronic
1088669975 11:112131421-112131443 CTGTTCCAGGGGAAGATCTGGGG - Intronic
1089269012 11:117288524-117288546 AAGCTCCAGAGGAAGATTTGGGG + Exonic
1094224198 12:28027023-28027045 GGGTTGCAATGGAAGATTTGAGG - Intergenic
1094251437 12:28366778-28366800 TGGTTTCAGTGGATGGTTTGTGG + Intronic
1096528677 12:52229989-52230011 AGGATGCAGTGAAAGAATTGAGG + Intergenic
1097422568 12:59398504-59398526 AAGCTCAAGTGGAAAATTTGAGG + Intergenic
1097450428 12:59731851-59731873 AGCTTCTAGTGGTAGAGTTGAGG - Intronic
1098660703 12:73089444-73089466 AGGTTCCTGTGGAATTTTTAGGG - Intergenic
1099232024 12:80038036-80038058 TGGTCCCAGAGGAAAATTTGGGG + Intergenic
1103283076 12:119776813-119776835 AGGCTCAAGTGGAAGAAATGAGG - Exonic
1104003585 12:124876018-124876040 AGGCTACAGTGGCAGAGTTGAGG + Intronic
1109096482 13:58123495-58123517 AGGTTCCAGAGGTACATATGTGG - Intergenic
1110999590 13:82163093-82163115 AGTTTACTGTGGTAGATTTGAGG + Intergenic
1112468528 13:99667122-99667144 AGGTTCTTTTGGAAGATGTGGGG + Intronic
1113065054 13:106364643-106364665 AGATTCAAGTGGAAGTTTTTGGG - Intergenic
1113183344 13:107657532-107657554 AGTTTACAGTGGAAGTTTTGGGG + Intronic
1115877819 14:37880453-37880475 AGGGCCCAGTGGAAGATGTTTGG + Intronic
1116116717 14:40661832-40661854 AAATTCCAGTGAAAGATTTTGGG - Intergenic
1117242582 14:53849776-53849798 GGATGCCAGTGGGAGATTTGTGG - Intergenic
1117620304 14:57579224-57579246 AGGTCACAGTGACAGATTTGGGG + Intronic
1117745342 14:58863712-58863734 GGCTTTCAGGGGAAGATTTGTGG - Intergenic
1118486763 14:66221766-66221788 AGGTTCTAGTGGCAGAGTTCAGG - Intergenic
1121897662 14:97663532-97663554 AGGCTCCAGTTCAAGATTTATGG - Intergenic
1122482728 14:102057912-102057934 AGCCTCCAGTGGAAGCTTTGTGG - Intergenic
1124155149 15:27219023-27219045 TGGTTCCATTGGGAGATTGGTGG - Intronic
1124592584 15:31066499-31066521 ACATTCCAGTGCAGGATTTGAGG - Intronic
1126213572 15:46128679-46128701 AGGTTCAAGGGGTAGATATGTGG + Intergenic
1133592373 16:7257765-7257787 AGATTTGAATGGAAGATTTGAGG + Intronic
1135385467 16:22035581-22035603 AGGTTTCTGTGGAGGTTTTGAGG + Intronic
1137065808 16:35841961-35841983 AGGATCTAGTAGGAGATTTGAGG - Intergenic
1138212941 16:55178504-55178526 AAGATCCAGGGGAAGGTTTGGGG - Intergenic
1139361845 16:66404319-66404341 ACGTTCCAGTGGAAGATGCATGG - Exonic
1140615526 16:76658030-76658052 ACGTTCCTTTGAAAGATTTGAGG + Intergenic
1142679218 17:1535996-1536018 AGATTGCACTGGAAGATTTAAGG - Intronic
1143540095 17:7563509-7563531 ACATTCCACTGGAAGCTTTGGGG + Exonic
1143881691 17:10034955-10034977 GGGTTCCAGTGGAATTTTTCTGG + Intronic
1144475160 17:15581560-15581582 ATGTTCTAGTGGAAGAATAGAGG - Intronic
1146798474 17:35799703-35799725 AGTTTCCATTATAAGATTTGTGG - Intronic
1147298548 17:39504927-39504949 AGGGAGCAGTTGAAGATTTGGGG + Intronic
1151360357 17:73584970-73584992 AGTCTCCAGTGGAAGATTAAAGG + Intronic
1152947867 17:83207721-83207743 GGGTTAAAGTGCAAGATTTGGGG - Intergenic
1153708340 18:7770647-7770669 AGCTAACAGTGGAAGAATTGGGG + Intronic
1157911484 18:51621175-51621197 AGGTACCAGAGGTGGATTTGTGG + Intergenic
1158684455 18:59600573-59600595 AGGTTCCACTGAAGGATATGTGG + Intronic
1162487243 19:10968739-10968761 CTGTTCCAGTGGGAGACTTGAGG + Intronic
1162907875 19:13834111-13834133 AGGCCTCAGGGGAAGATTTGGGG - Intergenic
1162910340 19:13844462-13844484 GGGCCCCAGGGGAAGATTTGGGG + Intergenic
1165894652 19:39134106-39134128 AGGCTGCAGTGGAAGATTTGCGG - Intronic
1166161980 19:40960825-40960847 AGATGCCAGTGGAGGCTTTGGGG + Intergenic
1166687135 19:44802098-44802120 AGATTCCATTTGAAGATCTGAGG - Intergenic
1167606908 19:50486142-50486164 AGTTTCCAGTAGACAATTTGGGG - Exonic
925792628 2:7507740-7507762 AGATTGCACTGAAAGATTTGGGG - Intergenic
929658647 2:43759742-43759764 AGGTACAAGAGGAAGATTTTAGG - Intronic
931080371 2:58762402-58762424 AGGTCCCAGGGCAAAATTTGTGG - Intergenic
931490756 2:62744077-62744099 GGGCTCCATTGGAAAATTTGAGG - Intronic
932340302 2:70959220-70959242 GGGGTTCAGTGGAAGATTTGGGG - Intronic
932849878 2:75174137-75174159 AGGGTTCAGTGGGGGATTTGGGG - Intronic
932880909 2:75501095-75501117 AGGCTCCTGTGGAAGAGTTTGGG - Intronic
932956210 2:76353962-76353984 AGGATTCAGTGTAAAATTTGGGG - Intergenic
935793390 2:106615107-106615129 AGGTCACAGTCGAAGATTTGGGG + Intergenic
936041193 2:109150769-109150791 AGGTAACAGTGTGAGATTTGAGG - Intronic
936106354 2:109627938-109627960 ACATTCCAATGAAAGATTTGTGG + Intergenic
936801350 2:116270323-116270345 AGGTTCCATTGAAATACTTGTGG - Intergenic
942034941 2:172001658-172001680 AGGGGCCACAGGAAGATTTGAGG + Intronic
943890301 2:193277490-193277512 AGCTGCCAGTGGAAGAGTTCAGG + Intergenic
944461059 2:199951146-199951168 AAGTTCCAGTGGCATATTTCTGG - Intronic
1169013813 20:2274605-2274627 AGGGTCCAGTGGAAACTTTAGGG + Intergenic
1169321250 20:4634987-4635009 ATTTTCCAGTGGAAGATGCGAGG - Intergenic
1169514584 20:6301972-6301994 AAGTTCCGGTGACAGATTTGTGG - Intergenic
1170849857 20:19994979-19995001 AGGTTGCAGATGAAGACTTGAGG - Intronic
1173772594 20:45675258-45675280 AGGTGCAAATTGAAGATTTGTGG - Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175622968 20:60466371-60466393 AGTTTCCAGAGGGAGGTTTGTGG - Intergenic
1176962591 21:15175937-15175959 TGGTTGCAGTGGCATATTTGAGG + Intergenic
1177173105 21:17675567-17675589 AGGTTCCAGGGGAAGGTCTCAGG + Intergenic
1178589030 21:33893675-33893697 AGGATCCAGAGGAAGCTGTGGGG - Exonic
1179539442 21:42074618-42074640 AGGCTCCAGTGAGAGATATGTGG + Intronic
1179804927 21:43831384-43831406 AGGGTCCTGTGGAGGATCTGGGG + Intergenic
1182095608 22:27623292-27623314 GGGTTCGAGTGATAGATTTGAGG - Intergenic
1182130689 22:27848322-27848344 AAGTTCCTGTAGAAGATTTTAGG - Intergenic
1182900767 22:33896468-33896490 AGGTACCAGGGGCACATTTGAGG + Intronic
949118270 3:355462-355484 AGGTTCCAGTGGAAGATTTGGGG - Intronic
950550522 3:13663405-13663427 AGGTCCGAGTGGAAGAGATGGGG - Intergenic
951409873 3:22349732-22349754 AGTTTCCAGTGCAATATTTATGG + Intronic
951933681 3:27998210-27998232 AGATTCCGGTGGAATATTTATGG - Intergenic
952166819 3:30758871-30758893 AGCTTCCAGTGGAATATATAGGG + Intronic
952306826 3:32154261-32154283 AGCTTCTAGTAGAAGCTTTGGGG + Intronic
954465189 3:50650277-50650299 AAGTTCCTGAGGTAGATTTGGGG - Intergenic
962581869 3:136805289-136805311 AGGCCCCAGTGGAAGTATTGGGG - Intergenic
962936799 3:140088791-140088813 AGCTTGCAGTGGAATATCTGAGG + Intronic
963800274 3:149669241-149669263 AGGTTCCCTTGTAAGATGTGGGG - Intronic
967872723 3:194245622-194245644 ATGTCCCATGGGAAGATTTGGGG + Intergenic
971375360 4:26051647-26051669 TGGTTCCAGTGCAAGCTTTGGGG + Intergenic
972552975 4:40150088-40150110 TGAATCCAGTGGAAGATTTGTGG + Intronic
974139653 4:57868697-57868719 AAGTTCCAGTGGAATATTGAAGG - Intergenic
980599463 4:135001241-135001263 AGTTTGCAGTGGCAGATCTGTGG - Intergenic
980605941 4:135089364-135089386 ATGTTCCAGAGGAACATTTCCGG + Intergenic
982331805 4:154189179-154189201 AGATTCCAGTGTATTATTTGGGG - Intergenic
982369087 4:154613587-154613609 TGGTTCCAGAGGAAGAAATGAGG - Intergenic
983519887 4:168697257-168697279 GGGTTCCAGAGGAAAATTTGGGG - Intronic
985199963 4:187474661-187474683 AGATTATAGTGAAAGATTTGAGG - Intergenic
992680595 5:79149171-79149193 AGGTGCCATAGAAAGATTTGGGG - Intronic
995492354 5:112706683-112706705 AGGAGCCACTGGAAGATCTGGGG - Intergenic
995760451 5:115556345-115556367 AGATTCCACTGGATCATTTGTGG + Intergenic
996671132 5:126118842-126118864 AGTTTCCAGGGCAAGGTTTGGGG + Intergenic
998052288 5:139046028-139046050 AGCTGCCATTGGAAGATTTTAGG - Intronic
998900451 5:146847641-146847663 AGGATTCAGTGGCAGAATTGTGG - Intronic
1000108291 5:158081977-158081999 AGGTTCTAGTAGAAAACTTGGGG - Intergenic
1002649501 5:180681251-180681273 ATTTTTCAGTGGGAGATTTGTGG + Intergenic
1002742030 5:181440875-181440897 GGGTTAAAGTGCAAGATTTGGGG - Intergenic
1004802154 6:19160850-19160872 AGCCTTCAGTGGTAGATTTGTGG - Intergenic
1007698059 6:43746484-43746506 AGGTTCCGGTGGACCATGTGAGG + Intergenic
1008456900 6:51721658-51721680 AAGTTCCAGTAGCAGATATGGGG - Intronic
1008478250 6:51956940-51956962 AGATTCCACTGGAGGTTTTGAGG + Intronic
1008876646 6:56336986-56337008 GGGTGGCAGGGGAAGATTTGTGG - Intronic
1009799082 6:68509936-68509958 AGGTTCCAGGGATAGCTTTGAGG + Intergenic
1010665557 6:78625902-78625924 CTGTTCCAGGGTAAGATTTGAGG - Intergenic
1011771605 6:90679428-90679450 AGGTTCAAGCGAAAGATATGTGG + Intergenic
1013571408 6:111430039-111430061 AGGTTCCAGGGGAAGAAAAGGGG + Intronic
1017418635 6:154249253-154249275 AGGTCCCAGGAGATGATTTGAGG - Intronic
1019247167 6:170716613-170716635 GGGTTAAAGTGCAAGATTTGGGG - Intergenic
1019764861 7:2843210-2843232 ATTTCCCACTGGAAGATTTGTGG - Intronic
1021351643 7:19601754-19601776 AGGAACCAGTGCAAGAATTGTGG - Intergenic
1022647133 7:32242081-32242103 AGGATCCATTATAAGATTTGTGG + Intronic
1024155536 7:46619507-46619529 AGGATCCAGTGTGGGATTTGGGG + Intergenic
1024760647 7:52593091-52593113 ATTTCACAGTGGAAGATTTGTGG + Intergenic
1025074165 7:55928005-55928027 ATATGTCAGTGGAAGATTTGGGG + Intronic
1026241308 7:68577855-68577877 AGGTTTCAGTGTAAGAATTTTGG - Intergenic
1026566375 7:71492882-71492904 AAGTAGCTGTGGAAGATTTGGGG + Intronic
1026870475 7:73848146-73848168 AGGTTCCAGAGGAAGAGCTTCGG - Intergenic
1027467433 7:78533471-78533493 AGGTTCCAGTGTAATCTCTGAGG + Intronic
1028852848 7:95555876-95555898 AAGTTCCAGAGGAAGATATTTGG - Intergenic
1030871338 7:114759783-114759805 AAGTTCCAGTGGGAGATGAGGGG - Intergenic
1031842197 7:126757324-126757346 AGGTGCCAGCTGAGGATTTGGGG + Intronic
1035969206 8:4228463-4228485 AGGATACAGTGGAAGCTGTGTGG - Intronic
1038662530 8:29509571-29509593 AGATTCCTGTAGAAGACTTGTGG + Intergenic
1038693121 8:29781251-29781273 ACGTTCCAGTGACAGCTTTGGGG - Intergenic
1042337787 8:67646744-67646766 AGCCTGCAGGGGAAGATTTGAGG + Intronic
1042586925 8:70350306-70350328 AGTTTTCAGTGGTATATTTGGGG - Intronic
1042744719 8:72095568-72095590 AGGTCACAGTGGAAGGTCTGTGG - Intronic
1044779191 8:95725827-95725849 AGCTTGCAGTGGAATGTTTGAGG - Intergenic
1044816020 8:96113847-96113869 AGGTTCCAGAGGAAGACATTAGG - Intergenic
1046478279 8:114778787-114778809 ATTTTCCAGTTGAAGGTTTGTGG + Intergenic
1048096598 8:131301814-131301836 AGGCTCCAGTTCCAGATTTGAGG + Intergenic
1049665064 8:143839367-143839389 AGGTTCCCGTGGATGATTGGGGG + Exonic
1051255362 9:15207500-15207522 GGGTTACAGTGAAAGAGTTGTGG + Intronic
1053587909 9:39479590-39479612 ATGTTCCTCTGGAAGATATGGGG + Intergenic
1054578393 9:66885652-66885674 ATGTTCCTCTGGAAGATATGGGG - Intronic
1058034970 9:100241514-100241536 AGGATCCAGAGGAAAATTTCAGG - Intronic
1058374923 9:104311487-104311509 AGGTTCCAGCAGAAGATATGTGG + Intergenic
1203607941 Un_KI270748v1:72091-72113 GGGTTAAAGTGCAAGATTTGGGG - Intergenic
1186322410 X:8443417-8443439 TGGTCCCAGTGGCAGTTTTGTGG + Intergenic
1189620788 X:42835097-42835119 AGGATGCAGTGGAATATTTCTGG + Intergenic
1189857034 X:45233821-45233843 AACTTCCAGTGGAAGAATAGGGG + Intergenic
1193239746 X:79154163-79154185 AGGCTCCAGTGTATGATATGAGG + Intergenic
1197273229 X:124448850-124448872 AGGTTCCCATGGAAGAGGTGAGG + Intronic
1197977035 X:132176708-132176730 ATGTTCCAGTGGGAAAATTGTGG - Intergenic
1199242568 X:145564766-145564788 AGGTATCAGTGGGACATTTGTGG + Intergenic