ID: 949121781

View in Genome Browser
Species Human (GRCh38)
Location 3:393300-393322
Sequence CCTTATATTAGTCGATGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 36}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949121779_949121781 2 Left 949121779 3:393275-393297 CCAATTCTAGATGTTGAGCTCTT 0: 1
1: 0
2: 0
3: 16
4: 174
Right 949121781 3:393300-393322 CCTTATATTAGTCGATGAACTGG 0: 1
1: 0
2: 0
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949121781 Original CRISPR CCTTATATTAGTCGATGAAC TGG Intronic
1068238767 10:54275542-54275564 ATTTAAATTAGTCCATGAACAGG + Intronic
1074892913 10:117750178-117750200 CCTTACATTTGTGGATGTACAGG - Intergenic
1078310680 11:10237999-10238021 CCTTATATAAGTCTATGTATGGG + Intronic
1080996887 11:37613846-37613868 CATTATATTACTAGAGGAACTGG - Intergenic
1082947315 11:58773794-58773816 CCTTATATGGCTCCATGAACAGG - Intergenic
1087515637 11:99155864-99155886 CCTAATATTATTTGATGACCAGG - Intronic
1087803369 11:102528551-102528573 CCTTAAATTAGTAGCAGAACTGG + Intronic
1095157576 12:38877225-38877247 CTTTATACTAGTCTATGAACAGG - Intronic
1097632006 12:62075535-62075557 CCTTATAGTTGTCTAGGAACAGG - Intronic
1099824855 12:87762049-87762071 CCTAATATTAGTCTAAGAATAGG + Intergenic
1106868370 13:33992183-33992205 CCTTATATTAGTTGACTTACAGG + Intergenic
1109883829 13:68516433-68516455 GCTTATATTAGTTGAAGAAATGG + Intergenic
1110127205 13:71960290-71960312 CATTATTTTAGTCACTGAACTGG + Intergenic
1110849606 13:80230459-80230481 CCTTCTAGTAGCCTATGAACTGG - Intergenic
1128644569 15:69366344-69366366 CCATTCATTAGTTGATGAACAGG + Intronic
1130238165 15:82158715-82158737 CCTTATAAAAGTCGATTAACTGG + Intronic
1149070868 17:52541019-52541041 CTTAAAATTAGTGGATGAACTGG - Intergenic
1150767675 17:68015095-68015117 CCTTAAATTTGTCTATGAAGAGG + Intergenic
1157909647 18:51603753-51603775 GCTTATCTTAGTCAATGGACTGG + Intergenic
944769650 2:202900722-202900744 CTTTATATTTGTGGAAGAACTGG - Intronic
1176875116 21:14119564-14119586 CTTTATATGAGGCGATGAAAGGG + Intronic
949121781 3:393300-393322 CCTTATATTAGTCGATGAACTGG + Intronic
953518339 3:43618675-43618697 TCTTTTATTAGTCTATGAATTGG - Intronic
955314398 3:57923927-57923949 CCTTTTAGAAGTTGATGAACTGG + Intronic
964533800 3:157697291-157697313 CATTATATTCGTGGTTGAACTGG - Intergenic
964573111 3:158132827-158132849 CCTTCAATTTGTCCATGAACAGG + Intronic
975725027 4:77283657-77283679 CCTTATTTTAGTCTATCAACAGG + Intronic
978407580 4:108396281-108396303 CCTTAAATAAGTCTATGAATGGG + Intergenic
979666144 4:123312965-123312987 CCTTATATTGGTAAATGAAAGGG - Intronic
981852693 4:149249810-149249832 CCTTTTATTTGTCCATGAACTGG + Intergenic
984963691 4:185122457-185122479 CCTTACATTAGTGGAATAACCGG + Intergenic
989709407 5:44378807-44378829 AATTATATTATTCGATGAAGTGG - Intronic
989728313 5:44615923-44615945 CCTTGTATTAGTCAAGGTACAGG - Intergenic
996319341 5:122196977-122196999 CCTAATTATAGTCAATGAACTGG + Intergenic
1000266478 5:159642589-159642611 CCTTATATTTGTCAATGTATGGG + Intergenic
1007516176 6:42413303-42413325 CCTAATATCAGTGGAGGAACAGG + Intronic
1037555269 8:20016140-20016162 ACTTATATTAGTGAATAAACAGG - Intergenic
1054796626 9:69308209-69308231 CCTTATATTAGTGGTTGTAGTGG + Intergenic
1058566192 9:106287723-106287745 CCTGAAATTTGTCGAGGAACAGG + Intergenic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1196539841 X:116894834-116894856 GCTAATAGAAGTCGATGAACAGG - Intergenic