ID: 949122921

View in Genome Browser
Species Human (GRCh38)
Location 3:409240-409262
Sequence ACGTGATTACCTTTTTCTTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949122921 Original CRISPR ACGTGATTACCTTTTTCTTT TGG Exonic
900831880 1:4971350-4971372 ACGTGAATAGCCTTTTCTTGGGG - Intergenic
901610522 1:10494440-10494462 ACCTGCTTACTTTATTCTTTTGG + Intronic
902241342 1:15091642-15091664 CCGTGTTTTCCTTTTTCATTTGG + Intronic
906735947 1:48128179-48128201 ACATAGTTATCTTTTTCTTTTGG - Intergenic
907894700 1:58675822-58675844 ACATGATTTAATTTTTCTTTTGG + Intronic
909783072 1:79573624-79573646 TAATGATTAACTTTTTCTTTAGG + Intergenic
910931946 1:92451680-92451702 ATGTGCTTTCATTTTTCTTTGGG + Intergenic
911519580 1:98912473-98912495 CAGTCATTACCTTTTTCATTTGG + Intronic
914508827 1:148312726-148312748 ATGTGGTTACGCTTTTCTTTTGG - Intergenic
915758567 1:158287489-158287511 ATGTGATTTTTTTTTTCTTTGGG + Intergenic
916316673 1:163456136-163456158 ACATTATATCCTTTTTCTTTAGG - Intergenic
917317911 1:173745962-173745984 ACATGAATACTTTTTTTTTTTGG - Intronic
918338745 1:183549176-183549198 ACTTAATTACCTTTTTTTCTGGG + Intronic
918848315 1:189647969-189647991 ACATCATTTTCTTTTTCTTTTGG - Intergenic
919758392 1:201080556-201080578 ACAAGATTATCTTTTTCTATGGG - Intronic
921688913 1:218124489-218124511 ACATGATTATTTTTTTCTTATGG - Intergenic
923547823 1:234936541-234936563 AAGTAATTACTTTTTTCCTTTGG - Intergenic
1063139882 10:3246674-3246696 AGCTGATGACCTTTTTGTTTTGG + Intergenic
1063696910 10:8345241-8345263 ATGTGATTATTTTTTTATTTTGG - Intergenic
1065272753 10:24052723-24052745 ATGTGATTACCTTTTTATTTGGG + Intronic
1068131340 10:52898769-52898791 ACTTGATTACATTTTTGCTTCGG + Intergenic
1069328364 10:67260037-67260059 ACTTGATTAGTTTATTCTTTAGG - Intronic
1070336581 10:75461155-75461177 ACAGGTTTACCTGTTTCTTTGGG - Intronic
1072969618 10:100006227-100006249 ACCTGATTACCTCTTGATTTGGG + Intronic
1073907050 10:108294692-108294714 ATATGAGTACCTTTTTCTTAGGG + Intergenic
1074614532 10:115053986-115054008 ATGTGATTTTCTTTTTCTTAGGG - Intergenic
1075507165 10:123034301-123034323 ACTTGAATATCATTTTCTTTGGG - Intronic
1077677593 11:4210146-4210168 ACTTGGTTTTCTTTTTCTTTTGG - Intergenic
1077771430 11:5223388-5223410 ACATAGTTACCTTTTTCTTGTGG + Intergenic
1078488484 11:11746631-11746653 ACGTGATTTTTTTTTTCCTTTGG - Intergenic
1080047988 11:27829459-27829481 ACATGTTTAACTTTTTATTTTGG - Intergenic
1080353742 11:31416748-31416770 ACCTGGTTTCCTATTTCTTTTGG - Intronic
1080627067 11:34040018-34040040 CAGTGATTACCTTTGTCATTAGG - Intergenic
1081213494 11:40365042-40365064 AAGTGGTTTCCTTTTTCTTGTGG - Intronic
1082176693 11:49068419-49068441 AAGTGATAACTTTTTTATTTGGG + Intergenic
1085724730 11:78944328-78944350 TCATCATTGCCTTTTTCTTTTGG - Intronic
1086279316 11:85167700-85167722 ACAGGTTTCCCTTTTTCTTTAGG + Intronic
1086699837 11:89888721-89888743 AAGTGATAACTTTTTTATTTGGG + Intergenic
1086706333 11:89955795-89955817 AAGTGATAACTTTTTTATTTGGG - Intergenic
1087387555 11:97490858-97490880 ACGAGGTTACATTTTTCATTAGG - Intergenic
1090815923 11:130295484-130295506 ACGTTATTTTCTGTTTCTTTAGG - Intronic
1091957812 12:4662405-4662427 ACATGATTACCTTTATCTGGAGG + Intronic
1093929468 12:24940685-24940707 AACTGATTTCCTTTTTCTTTTGG - Intronic
1095822523 12:46493933-46493955 ACGTCATTACCTTTGCCTCTGGG - Intergenic
1096074977 12:48797875-48797897 ACATGCTTATCTTTTTTTTTTGG + Intergenic
1096161024 12:49377489-49377511 ATATGATTACATTTTTCATTGGG + Intronic
1097105662 12:56622339-56622361 ACCTGATTATCTTTTTTTTTTGG - Intronic
1098225292 12:68315197-68315219 ACGATATTTCCTTTTTCTTCTGG + Exonic
1098274267 12:68797980-68798002 ATGTAATACCCTTTTTCTTTGGG + Intergenic
1100037472 12:90270525-90270547 ACGAGTTTACCGATTTCTTTGGG - Intergenic
1100125103 12:91415215-91415237 CCTTGCTTACCTTTTTCATTAGG - Intergenic
1101169613 12:102076630-102076652 AAGTCATTGCCTTTGTCTTTTGG - Intronic
1102418444 12:112784854-112784876 ACATGCTTACTTTATTCTTTTGG + Intronic
1105873713 13:24534792-24534814 AACTGATTACCTTTTTTTATTGG - Intergenic
1106149655 13:27086957-27086979 AAGTGATTATATTTTTGTTTTGG - Intronic
1106746358 13:32712547-32712569 ACTTAAATACATTTTTCTTTAGG - Intronic
1110519117 13:76454388-76454410 ACAGGATTTCATTTTTCTTTAGG - Intergenic
1110519822 13:76462437-76462459 AAATAATTACCTTTTTCATTTGG - Intergenic
1111438640 13:88247229-88247251 ACATAATTACTTTTTTATTTTGG + Intergenic
1111605407 13:90532375-90532397 AAGTGATTCCATTTTTATTTTGG - Intergenic
1112369611 13:98783463-98783485 AAGTGTTTCCCTTTTTCTCTTGG + Intergenic
1113359646 13:109618490-109618512 ACATTATCACCTTTTCCTTTGGG + Intergenic
1113526443 13:110981698-110981720 ACATGTTTCCCTATTTCTTTGGG + Intergenic
1114960775 14:27885814-27885836 GTGTGATTAGCTTTTTCTCTAGG - Intergenic
1118073858 14:62277122-62277144 GAGTAATTACCTTCTTCTTTAGG + Intergenic
1119961642 14:78864703-78864725 ACAGGATTCCCTGTTTCTTTGGG - Intronic
1120189222 14:81424812-81424834 CAGTGATTAAATTTTTCTTTTGG - Intronic
1120729773 14:87989768-87989790 TCGTGATTACATTTGTATTTTGG - Intronic
1120817306 14:88875580-88875602 ACGTGGTTCCCTTTAGCTTTCGG - Intronic
1121260645 14:92563662-92563684 AAGTGCTTCTCTTTTTCTTTTGG + Intronic
1202918794 14_KI270723v1_random:11968-11990 ACGTCATTGCCTCTTTTTTTTGG + Intergenic
1202925842 14_KI270724v1_random:23086-23108 ACGTCATTGCCTCTTTTTTTTGG - Intergenic
1202945434 14_KI270726v1_random:21642-21664 ACGCGATTTCATTTTCCTTTAGG + Intergenic
1124914421 15:33955343-33955365 ATGTAATTACATTCTTCTTTAGG + Intronic
1126080293 15:44954412-44954434 TTGTGGTTCCCTTTTTCTTTAGG - Intergenic
1128206304 15:65855445-65855467 TCCTGATTATCTTTTTTTTTTGG - Intronic
1128929579 15:71692032-71692054 ATGTGATTACTTGTTACTTTTGG - Intronic
1131322942 15:91413438-91413460 ATGTGATTGCCTTGTTCTGTTGG - Intergenic
1133072094 16:3253469-3253491 ACCTGATTGCCTTTTTCAATCGG + Intronic
1137335935 16:47549001-47549023 ACGTGGAAACCTTTTTCTTTAGG + Intronic
1139757256 16:69154445-69154467 ACTTCCTTACCTTTGTCTTTAGG - Exonic
1146838946 17:36136143-36136165 ATGTGATTAGCTTTTTTTGTGGG + Intergenic
1148865722 17:50627463-50627485 CCGTGATTAGCTTTTTATTTAGG - Intronic
1150026937 17:61686165-61686187 CTGGGTTTACCTTTTTCTTTAGG - Exonic
1150897414 17:69229633-69229655 AAATGATTACCATTTTCATTAGG + Intronic
1151217682 17:72588951-72588973 AAGTGATTCTCCTTTTCTTTAGG - Intergenic
1152871091 17:82753302-82753324 ACTTGATTGCCTGTTTCTTCGGG + Intronic
1153904766 18:9651387-9651409 ATCTGATTACCTTTATCCTTTGG - Intergenic
1155896054 18:31328080-31328102 ATGTGATGACCTTGTTATTTAGG - Intronic
1157162434 18:45326321-45326343 AAATGATTCCCTTTTTCTCTTGG + Intronic
1157666222 18:49489349-49489371 ACTTATTTACCTTTTTCTTCTGG + Exonic
1157768405 18:50322957-50322979 TCGTGATTAAATTTATCTTTTGG + Intergenic
1158914184 18:62103799-62103821 ATATGATTACCTTTCTCCTTAGG - Intronic
928142475 2:28742072-28742094 ACGGGATTACCTTTCTGATTTGG + Intergenic
928222779 2:29418714-29418736 ACTTGATTTCATTTTTCTTATGG + Intronic
929393376 2:41496345-41496367 ATGTAATTAACTTGTTCTTTAGG - Intergenic
929708085 2:44237232-44237254 ACTTGTTTAGCATTTTCTTTAGG - Intronic
930829132 2:55724647-55724669 AGGAGGTTACCTTTTTTTTTTGG - Intergenic
932874071 2:75432274-75432296 GCCTGATTACCTGATTCTTTTGG + Intergenic
933562701 2:83908042-83908064 ACGTGGTTTCCTTTAACTTTAGG + Intergenic
934584449 2:95478030-95478052 AAGTGATAACTTTTTTATTTGGG - Intergenic
934595003 2:95598685-95598707 AAGTGATAACTTTTTTATTTGGG + Intronic
934787763 2:97026841-97026863 AAGTGATAACTTTTTTATTTGGG - Intergenic
935462669 2:103356460-103356482 ACGAGTTTACCTCTTTCTTTAGG - Intergenic
937124883 2:119468219-119468241 AAATAATTACCCTTTTCTTTTGG - Intronic
938253751 2:129836837-129836859 CCCTGATTTCCTTTTTCTTGGGG - Intergenic
940613330 2:156018997-156019019 ACTTAATTACCTTTTTATTATGG - Intergenic
940664886 2:156596680-156596702 AAGTGATCACATTTTTATTTGGG - Intronic
941343846 2:164342792-164342814 AAGTCAGTACTTTTTTCTTTTGG + Intergenic
941694603 2:168537714-168537736 AGGTGATTTCCTTGTTCTTATGG + Intronic
942845504 2:180419716-180419738 ACTTGTTTAACTTTTACTTTAGG - Intergenic
943813366 2:192218899-192218921 AAGTGATTAACTTTTTCTGTCGG - Intergenic
944775652 2:202961499-202961521 AGGTGATAACATTTTTATTTTGG + Intronic
945517615 2:210782539-210782561 GAGTGGTTACCTTTTGCTTTAGG - Intergenic
945564498 2:211380312-211380334 ACCTGTTTACCACTTTCTTTAGG + Exonic
945779051 2:214144758-214144780 ATATAAATACCTTTTTCTTTTGG - Intronic
948931685 2:241136238-241136260 ATGTTTTTACCTTTTTCTTAAGG - Intronic
1169493549 20:6091616-6091638 ACCTTATTACCTGTATCTTTTGG - Intronic
1171723255 20:28587816-28587838 AAGTGATTACCTCTTTCTGGTGG + Intergenic
1171787855 20:29487251-29487273 AAGTGATTACCTCTTTCTGGTGG + Intergenic
1171860090 20:30392139-30392161 AAGTGATTACCTCTTTCTGGTGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1177594984 21:23226940-23226962 ACGTCATTTTTTTTTTCTTTTGG - Intergenic
1177680424 21:24361251-24361273 ACATGATTTCCTTTTTTTTTTGG + Intergenic
1179004720 21:37502833-37502855 ACTTGTTTACCTTTATTTTTTGG + Intronic
1179577027 21:42314236-42314258 ACGTGATTGCCATTTTCCTAAGG - Intronic
1180296809 22:10946465-10946487 AAGTGATTACCTCTTTCTGGTGG + Intergenic
1181374823 22:22448820-22448842 AAGTGATTTCCTTTTGCTGTGGG + Intergenic
949122921 3:409240-409262 ACGTGATTACCTTTTTCTTTTGG + Exonic
949748211 3:7320330-7320352 ACAGGTTTCCCTTTTTCTTTTGG - Intronic
950362741 3:12461436-12461458 GGGTGATTTCCTTTTTGTTTGGG + Intergenic
951436327 3:22669529-22669551 ACATAATTACCTTTTGCTTCTGG + Intergenic
951671383 3:25186866-25186888 ACAGGCTTACCTTTTTCTTTGGG - Intronic
951693243 3:25419019-25419041 ACAGGCTTACCTATTTCTTTGGG - Intronic
954823417 3:53350481-53350503 ACCTGATTGCCTTTTTCAATGGG - Intergenic
955341002 3:58124959-58124981 ACGGGTTTCGCTTTTTCTTTTGG + Intronic
955553605 3:60111507-60111529 ATGTAATTACCCATTTCTTTGGG + Intronic
957975454 3:87437690-87437712 ACCTAACTACTTTTTTCTTTTGG - Intergenic
958917466 3:100065594-100065616 AAGTGAATACTTTTTTCATTAGG - Intronic
958928278 3:100182312-100182334 ATGTGACTTACTTTTTCTTTTGG - Intergenic
960172904 3:114483773-114483795 AGTTGATTAACTTTTTATTTGGG + Intronic
960275392 3:115723088-115723110 ACTTTCTAACCTTTTTCTTTAGG - Intergenic
960330797 3:116358189-116358211 AAGCAATTAGCTTTTTCTTTGGG - Intronic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
963383638 3:144562640-144562662 AGGTAATTACTTTTTTCTTTTGG + Intergenic
963881267 3:150531682-150531704 ATGTGATTTCTTTTTTCTCTTGG - Intergenic
964548351 3:157859649-157859671 AAATGATTATCTTTTTTTTTTGG + Intergenic
964828648 3:160858504-160858526 AAGTGAATAACTTTTGCTTTGGG - Intronic
969013809 4:4089372-4089394 TTGTGATTATTTTTTTCTTTGGG - Intergenic
970093722 4:12438119-12438141 ACGTAATTGCCTTTTAATTTTGG - Intergenic
970244164 4:14041093-14041115 CCCTGATCATCTTTTTCTTTAGG - Intergenic
970656926 4:18241541-18241563 ACATGATTTCATTTTTCTTATGG + Intergenic
974845261 4:67344280-67344302 ACGGGTTTCCCTGTTTCTTTGGG - Intergenic
974895780 4:67936570-67936592 ATCTGATTACCTTTTTGTTTAGG - Intronic
975040288 4:69738185-69738207 ACATGATTTCCTTTTCCTTATGG + Intronic
981768277 4:148277139-148277161 TCGAGATCATCTTTTTCTTTTGG + Intronic
981976826 4:150740422-150740444 AATTGTTTACATTTTTCTTTTGG - Intronic
982954015 4:161739676-161739698 AGGTGTTTACCTTTGCCTTTGGG - Intronic
982983976 4:162180769-162180791 AACTGATTACACTTTTCTTTGGG - Intergenic
984133529 4:175907809-175907831 ACATGTTTATCTATTTCTTTGGG + Intronic
984657123 4:182330259-182330281 ACAAGTTTACCTGTTTCTTTGGG - Intronic
984982519 4:185296498-185296520 TCTTGATGGCCTTTTTCTTTTGG + Intronic
985419705 4:189772518-189772540 AGGTGCATACCTTATTCTTTTGG + Intergenic
985429745 4:189867760-189867782 ACAAGATTTCCTGTTTCTTTGGG - Intergenic
985438255 4:189955975-189955997 AAGTGATTACCTCTTTCTGGAGG - Intronic
986775871 5:11013274-11013296 ACAAGTTTACCTGTTTCTTTGGG + Intronic
987076706 5:14389397-14389419 AAGTGAGTGGCTTTTTCTTTGGG + Exonic
988194506 5:27985545-27985567 ACGTGAATATTTTATTCTTTGGG + Intergenic
988419608 5:30989353-30989375 ACAGGTTTTCCTTTTTCTTTGGG - Intergenic
989796141 5:45475707-45475729 ACATTATTATTTTTTTCTTTTGG + Intronic
990809531 5:59706869-59706891 ATGTGGATACCATTTTCTTTAGG - Intronic
992062091 5:73062739-73062761 GTGTGACTACCTTTTTCTTTAGG + Intronic
993571251 5:89541733-89541755 AGGTGATTTACTTTTTTTTTAGG + Intergenic
995085971 5:108109516-108109538 ACAGGTTTACCTGTTTCTTTAGG + Intronic
996586298 5:125091315-125091337 AGATGATTATATTTTTCTTTTGG - Intergenic
998990825 5:147814073-147814095 ACAAGTTTACCTGTTTCTTTGGG + Intergenic
999923548 5:156349750-156349772 ACATAATGACTTTTTTCTTTTGG - Intronic
1000629419 5:163574614-163574636 AGGAGATTTCCTTTTTCTTCTGG + Intergenic
1000681525 5:164190919-164190941 AGGTTATTATCTTTTTCTATGGG - Intergenic
1000928376 5:167221261-167221283 ACATGCTTACCATTTACTTTGGG - Intergenic
1003620906 6:7699030-7699052 ACCTGATTAATTTTCTCTTTGGG + Intergenic
1004442781 6:15669892-15669914 ACAAGATTACCTGTTCCTTTGGG + Intergenic
1004661395 6:17713200-17713222 GCTAGATTACCTTTTTCCTTTGG - Intergenic
1006656146 6:35594935-35594957 ACAGGATTTCCTTTTTCTTGTGG + Intronic
1008982368 6:57499624-57499646 ACACGTTTCCCTTTTTCTTTCGG + Intronic
1009042786 6:58200382-58200404 AGGTGATTAACTGTTTCATTAGG - Intergenic
1009170434 6:60392460-60392482 ACATGTTTCCCTGTTTCTTTGGG + Intergenic
1009218621 6:60954618-60954640 AGGTGATTAACTGTTTCATTAGG - Intergenic
1010672705 6:78705573-78705595 ATGTGATTTCCTTATTCATTAGG + Intergenic
1011854337 6:91669876-91669898 ACTTAATTACCTTTTTAATTAGG - Intergenic
1013068215 6:106704132-106704154 ACGGGTTTACCTGTTTCTTTGGG + Intergenic
1016195402 6:141330945-141330967 ATGTCATTACATATTTCTTTTGG - Intergenic
1017982311 6:159411089-159411111 CCGAGATTAACTTTTCCTTTTGG + Intergenic
1018278563 6:162159463-162159485 ACATGCTTACCATTTTATTTAGG - Intronic
1018296502 6:162351517-162351539 AAGAGATTGCCATTTTCTTTGGG + Intronic
1024299644 7:47877163-47877185 ACGTGCCTGCCTTTTTCTTGGGG + Intronic
1027893646 7:84011633-84011655 AATTGATTTCCTTTTTCTTAAGG - Intronic
1028317610 7:89422958-89422980 TCATGATTTCTTTTTTCTTTTGG - Intergenic
1028617128 7:92780969-92780991 TTGTGATTACATTTTTCTTATGG - Intronic
1030217531 7:107060840-107060862 AAGAGATTACCTTTTTAATTTGG - Intronic
1030407784 7:109136489-109136511 TACTGATTTCCTTTTTCTTTTGG + Intergenic
1033575566 7:142680610-142680632 ATATGATTGCCTTTTTCTGTAGG - Intergenic
1034607846 7:152334087-152334109 ATCTGAATACCTTTTTTTTTGGG - Intronic
1036005860 8:4662968-4662990 ACATGATTTCCTTTTTCATGTGG + Intronic
1036778627 8:11630598-11630620 ACGTGATTTCCTTCTTTTTATGG + Intergenic
1038280227 8:26157665-26157687 ATGTGATTTCTTTTTTCTTGGGG + Intergenic
1038329001 8:26592937-26592959 AAGTGATTACTGATTTCTTTAGG + Intronic
1039087382 8:33793423-33793445 ACATCATAGCCTTTTTCTTTCGG + Intergenic
1039253427 8:35691623-35691645 ACATCATTACCTTTTTCCTCTGG - Intronic
1039284250 8:36023156-36023178 ATTAGATTACCTTTTTGTTTGGG + Intergenic
1041586377 8:59524871-59524893 AAGTGATTACATTTTAATTTGGG - Intergenic
1041818978 8:62007353-62007375 ACTGGATTTCTTTTTTCTTTTGG - Intergenic
1042646919 8:70997335-70997357 ACAAGTTTACCTGTTTCTTTGGG + Intergenic
1043737497 8:83767061-83767083 ATGGGATTACCTTTCTCATTTGG - Intergenic
1045911887 8:107419526-107419548 ATGTGCTTACTTGTTTCTTTGGG + Intronic
1047357279 8:124135132-124135154 ACGTGATCACATTTTTTTTATGG - Intergenic
1047987687 8:130252623-130252645 CTGTGATTACAGTTTTCTTTTGG - Intronic
1050268230 9:3913986-3914008 ACGTGATTTCATTTGTCTTTGGG - Intronic
1051164991 9:14252084-14252106 CTGTGATTACCCTTATCTTTCGG + Intronic
1053726846 9:41012553-41012575 AAGTGATTACCTCTTTCTGGTGG - Intergenic
1054339097 9:63839242-63839264 AAGTGATTACCTCTTTCTGGTGG + Intergenic
1054983461 9:71234273-71234295 AAGTCACTACCATTTTCTTTTGG + Intronic
1055080599 9:72264804-72264826 ACAGGTTTACCTGTTTCTTTGGG - Intergenic
1055367274 9:75557958-75557980 AAGTGTTTAACTTTGTCTTTGGG + Intergenic
1055592173 9:77828462-77828484 TCCTAATTACTTTTTTCTTTTGG + Intronic
1055735474 9:79324699-79324721 AGCTGATTACCTTTAACTTTTGG + Intergenic
1056011884 9:82340717-82340739 ACTTGTTTACCTTATTCTTTGGG + Intergenic
1059568449 9:115407944-115407966 AAGTGATTACCTTTTTCTTCTGG - Intergenic
1202803671 9_KI270720v1_random:27633-27655 AAGTGATTACCTCTTTCTGGTGG + Intergenic
1203448466 Un_GL000219v1:84706-84728 AAGTGATTACCTCTTTCTGGTGG + Intergenic
1186820608 X:13284222-13284244 ACCTGAGTGGCTTTTTCTTTGGG + Intergenic
1188034380 X:25300419-25300441 ACAAGCTTACCTGTTTCTTTGGG + Intergenic
1191007379 X:55723960-55723982 ACTTGTTTACATTTTTCTTATGG + Intronic
1191863670 X:65686529-65686551 ATGTCATTTCCTTTTCCTTTTGG - Intronic
1193433609 X:81443741-81443763 ACGATATTATCTTTTTTTTTCGG + Intergenic
1194065859 X:89261006-89261028 AACTGTTTACCTGTTTCTTTGGG + Intergenic
1194356552 X:92892085-92892107 AAGTGATTACATTCTTATTTTGG + Intergenic
1195286866 X:103394293-103394315 ACTTCATTACCATTGTCTTTTGG - Intergenic
1196053469 X:111330445-111330467 ACTTGTTTCCCTTTTTGTTTTGG + Intronic
1197747746 X:129943987-129944009 AGGTGTTTATCTTTTTCTTGTGG + Intergenic
1198113558 X:133523704-133523726 ACATGAAGACCTTTTTCCTTAGG + Intergenic
1198897005 X:141466607-141466629 GGGTGATTAGCTTTGTCTTTTGG + Intergenic
1199379886 X:147158048-147158070 ATGGGATTACCTTTTTTATTTGG - Intergenic
1199424569 X:147685840-147685862 AGAGGATTCCCTTTTTCTTTTGG - Intergenic
1200664887 Y:6009085-6009107 AAGTGATTACATTCTTATTTTGG + Intergenic
1201930547 Y:19340522-19340544 ATATAATGACCTTTTTCTTTGGG + Intergenic