ID: 949124365

View in Genome Browser
Species Human (GRCh38)
Location 3:428727-428749
Sequence AGATTGCAAAATATGTCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949124364_949124365 29 Left 949124364 3:428675-428697 CCTTTTGGCAGTTATTTTCGTTT No data
Right 949124365 3:428727-428749 AGATTGCAAAATATGTCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949124365 Original CRISPR AGATTGCAAAATATGTCTCG TGG Intergenic
No off target data available for this crispr