ID: 949125025

View in Genome Browser
Species Human (GRCh38)
Location 3:436811-436833
Sequence GCTTTAATGGGGAAAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949125016_949125025 7 Left 949125016 3:436781-436803 CCAAAGATGAGTGGGCCACATAG No data
Right 949125025 3:436811-436833 GCTTTAATGGGGAAAGACGGAGG No data
949125020_949125025 -8 Left 949125020 3:436796-436818 CCACATAGGGCAAAGGCTTTAAT No data
Right 949125025 3:436811-436833 GCTTTAATGGGGAAAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949125025 Original CRISPR GCTTTAATGGGGAAAGACGG AGG Intergenic
No off target data available for this crispr