ID: 949138236

View in Genome Browser
Species Human (GRCh38)
Location 3:598697-598719
Sequence ATTTTATTCTGAGACATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949138233_949138236 -8 Left 949138233 3:598682-598704 CCTTCTGGTTTCCTCATTTTATT No data
Right 949138236 3:598697-598719 ATTTTATTCTGAGACATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949138236 Original CRISPR ATTTTATTCTGAGACATCAA GGG Intergenic
No off target data available for this crispr