ID: 949140121

View in Genome Browser
Species Human (GRCh38)
Location 3:622462-622484
Sequence TTGGCCAATGTGAAGTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949140121_949140126 19 Left 949140121 3:622462-622484 CCTAACAACTTCACATTGGCCAA No data
Right 949140126 3:622504-622526 TCCAAGGTCAAGGAGGAAGAAGG No data
949140121_949140123 3 Left 949140121 3:622462-622484 CCTAACAACTTCACATTGGCCAA No data
Right 949140123 3:622488-622510 AGATCACATGACTATGTCCAAGG No data
949140121_949140124 9 Left 949140121 3:622462-622484 CCTAACAACTTCACATTGGCCAA No data
Right 949140124 3:622494-622516 CATGACTATGTCCAAGGTCAAGG No data
949140121_949140125 12 Left 949140121 3:622462-622484 CCTAACAACTTCACATTGGCCAA No data
Right 949140125 3:622497-622519 GACTATGTCCAAGGTCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949140121 Original CRISPR TTGGCCAATGTGAAGTTGTT AGG (reversed) Intergenic
No off target data available for this crispr