ID: 949140122

View in Genome Browser
Species Human (GRCh38)
Location 3:622481-622503
Sequence CATAGTCATGTGATCTGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949140122_949140128 17 Left 949140122 3:622481-622503 CCAACGCAGATCACATGACTATG No data
Right 949140128 3:622521-622543 AGAAGGTGTTGCAAAGTCACAGG No data
949140122_949140125 -7 Left 949140122 3:622481-622503 CCAACGCAGATCACATGACTATG No data
Right 949140125 3:622497-622519 GACTATGTCCAAGGTCAAGGAGG No data
949140122_949140129 23 Left 949140122 3:622481-622503 CCAACGCAGATCACATGACTATG No data
Right 949140129 3:622527-622549 TGTTGCAAAGTCACAGGACAAGG No data
949140122_949140126 0 Left 949140122 3:622481-622503 CCAACGCAGATCACATGACTATG No data
Right 949140126 3:622504-622526 TCCAAGGTCAAGGAGGAAGAAGG No data
949140122_949140124 -10 Left 949140122 3:622481-622503 CCAACGCAGATCACATGACTATG No data
Right 949140124 3:622494-622516 CATGACTATGTCCAAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949140122 Original CRISPR CATAGTCATGTGATCTGCGT TGG (reversed) Intergenic
No off target data available for this crispr