ID: 949140123

View in Genome Browser
Species Human (GRCh38)
Location 3:622488-622510
Sequence AGATCACATGACTATGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949140121_949140123 3 Left 949140121 3:622462-622484 CCTAACAACTTCACATTGGCCAA No data
Right 949140123 3:622488-622510 AGATCACATGACTATGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949140123 Original CRISPR AGATCACATGACTATGTCCA AGG Intergenic
No off target data available for this crispr