ID: 949140126

View in Genome Browser
Species Human (GRCh38)
Location 3:622504-622526
Sequence TCCAAGGTCAAGGAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949140121_949140126 19 Left 949140121 3:622462-622484 CCTAACAACTTCACATTGGCCAA No data
Right 949140126 3:622504-622526 TCCAAGGTCAAGGAGGAAGAAGG No data
949140122_949140126 0 Left 949140122 3:622481-622503 CCAACGCAGATCACATGACTATG No data
Right 949140126 3:622504-622526 TCCAAGGTCAAGGAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949140126 Original CRISPR TCCAAGGTCAAGGAGGAAGA AGG Intergenic
No off target data available for this crispr