ID: 949146187

View in Genome Browser
Species Human (GRCh38)
Location 3:702299-702321
Sequence CAGTGCAAACAGCATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949146187_949146190 23 Left 949146187 3:702299-702321 CCTTCCACATGCTGTTTGCACTG No data
Right 949146190 3:702345-702367 ATTTGAATTGTATGCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949146187 Original CRISPR CAGTGCAAACAGCATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr