ID: 949152062

View in Genome Browser
Species Human (GRCh38)
Location 3:781301-781323
Sequence GGCCAAGGAGCCACATTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949152062_949152068 4 Left 949152062 3:781301-781323 CCCCAGAATGTGGCTCCTTGGCC No data
Right 949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG No data
949152062_949152067 0 Left 949152062 3:781301-781323 CCCCAGAATGTGGCTCCTTGGCC No data
Right 949152067 3:781324-781346 TTTGATAAAACAGCAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949152062 Original CRISPR GGCCAAGGAGCCACATTCTG GGG (reversed) Intergenic
No off target data available for this crispr