ID: 949152064

View in Genome Browser
Species Human (GRCh38)
Location 3:781303-781325
Sequence AAGGCCAAGGAGCCACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949152064_949152067 -2 Left 949152064 3:781303-781325 CCAGAATGTGGCTCCTTGGCCTT No data
Right 949152067 3:781324-781346 TTTGATAAAACAGCAGAATGAGG No data
949152064_949152068 2 Left 949152064 3:781303-781325 CCAGAATGTGGCTCCTTGGCCTT No data
Right 949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949152064 Original CRISPR AAGGCCAAGGAGCCACATTC TGG (reversed) Intergenic
No off target data available for this crispr