ID: 949152068

View in Genome Browser
Species Human (GRCh38)
Location 3:781328-781350
Sequence ATAAAACAGCAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949152064_949152068 2 Left 949152064 3:781303-781325 CCAGAATGTGGCTCCTTGGCCTT No data
Right 949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG No data
949152063_949152068 3 Left 949152063 3:781302-781324 CCCAGAATGTGGCTCCTTGGCCT No data
Right 949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG No data
949152062_949152068 4 Left 949152062 3:781301-781323 CCCCAGAATGTGGCTCCTTGGCC No data
Right 949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949152068 Original CRISPR ATAAAACAGCAGAATGAGGA AGG Intergenic
No off target data available for this crispr