ID: 949158937

View in Genome Browser
Species Human (GRCh38)
Location 3:858159-858181
Sequence CTGTTCTAGTGTAAGGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949158937_949158943 29 Left 949158937 3:858159-858181 CCACAAACCTTACACTAGAACAG No data
Right 949158943 3:858211-858233 TTTACAATCTAAGACATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949158937 Original CRISPR CTGTTCTAGTGTAAGGTTTG TGG (reversed) Intergenic
No off target data available for this crispr