ID: 949167874 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:962626-962648 |
Sequence | CTGCATGGAGAGATGGGGAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
949167874_949167880 | 12 | Left | 949167874 | 3:962626-962648 | CCTTTCCCCATCTCTCCATGCAG | No data | ||
Right | 949167880 | 3:962661-962683 | ACAATTTATAAGTGTAGAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
949167874 | Original CRISPR | CTGCATGGAGAGATGGGGAA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |