ID: 949167874

View in Genome Browser
Species Human (GRCh38)
Location 3:962626-962648
Sequence CTGCATGGAGAGATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949167874_949167880 12 Left 949167874 3:962626-962648 CCTTTCCCCATCTCTCCATGCAG No data
Right 949167880 3:962661-962683 ACAATTTATAAGTGTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949167874 Original CRISPR CTGCATGGAGAGATGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr