ID: 949168476

View in Genome Browser
Species Human (GRCh38)
Location 3:969470-969492
Sequence CTGTGTGACCCAGGGCAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949168476_949168480 11 Left 949168476 3:969470-969492 CCGACTTGCCCTGGGTCACACAG No data
Right 949168480 3:969504-969526 TGATTCCAGAATTTGTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949168476 Original CRISPR CTGTGTGACCCAGGGCAAGT CGG (reversed) Intergenic
No off target data available for this crispr