ID: 949168677

View in Genome Browser
Species Human (GRCh38)
Location 3:971849-971871
Sequence CAGTGAGATGCCATGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949168670_949168677 19 Left 949168670 3:971807-971829 CCTGGACTTTAAAGGGATGGTGG No data
Right 949168677 3:971849-971871 CAGTGAGATGCCATGTTGTGAGG No data
949168668_949168677 24 Left 949168668 3:971802-971824 CCAGGCCTGGACTTTAAAGGGAT No data
Right 949168677 3:971849-971871 CAGTGAGATGCCATGTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949168677 Original CRISPR CAGTGAGATGCCATGTTGTG AGG Intergenic
No off target data available for this crispr