ID: 949168986

View in Genome Browser
Species Human (GRCh38)
Location 3:976174-976196
Sequence TACTCATTTTGCATTATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949168986_949168989 21 Left 949168986 3:976174-976196 CCATAGATAATGCAAAATGAGTA No data
Right 949168989 3:976218-976240 ACCTCATTTACAAAAACAGGCGG No data
949168986_949168988 18 Left 949168986 3:976174-976196 CCATAGATAATGCAAAATGAGTA No data
Right 949168988 3:976215-976237 AAAACCTCATTTACAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949168986 Original CRISPR TACTCATTTTGCATTATCTA TGG (reversed) Intergenic
No off target data available for this crispr