ID: 949169125

View in Genome Browser
Species Human (GRCh38)
Location 3:977645-977667
Sequence CCTCCAATACTGAATGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949169125_949169127 -7 Left 949169125 3:977645-977667 CCTTTTACATTCAGTATTGGAGG No data
Right 949169127 3:977661-977683 TTGGAGGCCTATGAATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949169125 Original CRISPR CCTCCAATACTGAATGTAAA AGG (reversed) Intergenic
No off target data available for this crispr