ID: 949170186

View in Genome Browser
Species Human (GRCh38)
Location 3:987763-987785
Sequence CTAGTTATGTATTCTGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949170184_949170186 -1 Left 949170184 3:987741-987763 CCAGCTACTAAGTATGTCTATGC 0: 10
1: 144
2: 163
3: 131
4: 188
Right 949170186 3:987763-987785 CTAGTTATGTATTCTGGCTCTGG No data
949170181_949170186 28 Left 949170181 3:987712-987734 CCAGTCAGGGAACAAATGTGGGG No data
Right 949170186 3:987763-987785 CTAGTTATGTATTCTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949170186 Original CRISPR CTAGTTATGTATTCTGGCTC TGG Intergenic
No off target data available for this crispr