ID: 949174470

View in Genome Browser
Species Human (GRCh38)
Location 3:1042764-1042786
Sequence TGGTTATAGGGTAAATTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949174466_949174470 12 Left 949174466 3:1042729-1042751 CCTTTCATCTCAACATGAAGATT No data
Right 949174470 3:1042764-1042786 TGGTTATAGGGTAAATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949174470 Original CRISPR TGGTTATAGGGTAAATTTTG TGG Intergenic
No off target data available for this crispr