ID: 949178042

View in Genome Browser
Species Human (GRCh38)
Location 3:1090717-1090739
Sequence CAGGCTACACAGAATTACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949178042 Original CRISPR CAGGCTACACAGAATTACTA AGG (reversed) Intergenic
901250444 1:7774300-7774322 CAGGCAGGACAGAATTACAATGG - Intronic
904676966 1:32204606-32204628 AAGGATACATAGAATTACTGAGG - Exonic
904985200 1:34540564-34540586 CTGGCTTCACAGAATTAGTTGGG - Intergenic
907057383 1:51382875-51382897 CTGGCTTCACAGAATGAGTATGG - Intronic
909242866 1:73237625-73237647 CAGGCCACCAGGAATTACTATGG - Intergenic
911316547 1:96362911-96362933 CAGGCTCTACAGAACAACTATGG - Intergenic
919312948 1:195934549-195934571 CAGGGTAGAGAGAATTTCTAAGG - Intergenic
920155577 1:203947816-203947838 CAGGTCTCAAAGAATTACTAAGG - Intergenic
920183928 1:204149056-204149078 CAGGCTCCACAGCATTCCCAGGG + Intronic
921500712 1:215899352-215899374 CAAGCTACACAGAGTGAATAAGG - Intronic
1068571278 10:58632297-58632319 CAGGCTTCACAGAGCTGCTAAGG + Intronic
1069070705 10:63988150-63988172 TAGGCTAAACAGTATTACAAAGG - Intergenic
1071305373 10:84294782-84294804 CAGAGGACAGAGAATTACTATGG + Intergenic
1074181038 10:111063665-111063687 CAGACAACACAGAAATACAAAGG + Intergenic
1076049266 10:127319787-127319809 CAGGTTAAACACAATTAGTAAGG - Intronic
1076429679 10:130393028-130393050 CTGGCTACACAGATGTACTTGGG - Intergenic
1078384545 11:10877208-10877230 CTGGCTTCACAGAATGACTTAGG + Intergenic
1078470342 11:11581273-11581295 CAGGCCTCACAGAATCACCAAGG + Intronic
1080306508 11:30842913-30842935 CAGGCTTCAGAGGATTACCATGG - Intronic
1080486212 11:32709716-32709738 CTGGCTTCACAGAATGATTAAGG + Intronic
1081742279 11:45449032-45449054 CAGTCTACACAGAGATACAAAGG + Intergenic
1088093892 11:106076691-106076713 CAGCCTACACGGAACAACTAAGG + Intronic
1091111425 11:132972424-132972446 CAGGCAACACACAGTTACCAAGG + Intronic
1091653732 12:2328874-2328896 CAGCCTCCACAGAATGACTAAGG + Intronic
1092505708 12:9097580-9097602 CAAGCTACACATAATTTCTGAGG - Intronic
1095705517 12:45232903-45232925 GAAGCTACACAGAATTGCTGCGG - Intronic
1097513829 12:60577794-60577816 CAGGATAAACAGACTTACTATGG - Intergenic
1102070221 12:110012746-110012768 CAGTCAACACAAAATTACTCTGG - Intronic
1102333462 12:112056490-112056512 GAGGCTACAGAGAGCTACTATGG + Intronic
1107903168 13:45038408-45038430 CAGGGTACACAGAATCACCTGGG - Intergenic
1107961046 13:45558937-45558959 CTGGCTTCACAGAATGATTAAGG + Intronic
1112074096 13:95889799-95889821 CTGGCTACACTGAATGACAAGGG - Intronic
1113546101 13:111152606-111152628 CAGGCTACTCAGGAATACTGTGG - Intronic
1121227003 14:92328453-92328475 CAGGCTACACAGAAGGACACCGG - Intronic
1121703821 14:95976212-95976234 CAGGGTACAAAGAAATAGTAAGG - Intergenic
1125337088 15:38637349-38637371 TTGGTTACACAGAATTAATATGG + Intergenic
1127246872 15:57186592-57186614 CTGGCTTCACAGAATTAATTAGG - Intronic
1134795117 16:17028042-17028064 CTGGATAAACAGAATAACTATGG - Intergenic
1138795146 16:59958846-59958868 CAGGCTGCAAAGACTCACTAGGG + Intergenic
1139187541 16:64824415-64824437 CTGGCTACTCACAATTCCTAGGG - Intergenic
1140168047 16:72574956-72574978 CAGGCTACAGATAATTTTTAAGG - Intergenic
1140653578 16:77115900-77115922 CAGGCTGTACAGAATTAGGAAGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1151715924 17:75831052-75831074 CAGGCTCCCCAGACTTCCTACGG + Intronic
1158712743 18:59852031-59852053 CAAGCTACTTAGAATTACTGAGG - Intergenic
1158989940 18:62857969-62857991 CACGCTACACAGGATTCCTACGG - Intronic
1160132558 18:76239790-76239812 CAGAATAAAGAGAATTACTAGGG + Intergenic
1161303813 19:3556267-3556289 CAGGCTAGACAGACTGACAAAGG + Intronic
1165211216 19:34237319-34237341 CAGGCTAAAAACAGTTACTAAGG - Intergenic
1167981848 19:53282388-53282410 AAGGCTGCACAGAAAGACTAGGG - Intergenic
1167984245 19:53301274-53301296 AAGGCTGCACAGAAAGACTAGGG + Intergenic
934513139 2:94964348-94964370 CAGGGGACACAGAATCACGATGG - Intergenic
938392105 2:130914779-130914801 CAGGGGACACAGAATTGCTCTGG + Intronic
942521516 2:176809141-176809163 AAGGGTACACAGAGTTAATATGG - Intergenic
944793675 2:203160731-203160753 CAGGCTCTACAGAATTAGTTCGG - Intronic
947405244 2:229769340-229769362 AAGGGTAAAAAGAATTACTAAGG + Intronic
1173547704 20:43911642-43911664 CAGTCTTCACAGAAATACTCTGG - Intergenic
1177723152 21:24933566-24933588 CAGGCTACACTAAATTTATAAGG - Intergenic
1182618147 22:31602511-31602533 CAGGCCACAAATAATGACTAAGG - Intronic
1183837173 22:40464383-40464405 CAAACTACACAGAATGACAATGG + Intronic
949178042 3:1090717-1090739 CAGGCTACACAGAATTACTAAGG - Intergenic
951261089 3:20509889-20509911 CTGGCTTCACAGAATTAGTTAGG + Intergenic
952309959 3:32179796-32179818 CAGGCCACACAGGATAACAAGGG - Intergenic
955016968 3:55079858-55079880 CAAGTTACCCAGAGTTACTAGGG + Intergenic
957150243 3:76477032-76477054 GAGGCTACACAGTTTGACTAAGG - Intronic
959442879 3:106400236-106400258 CTGGCTAAAAAGCATTACTAAGG + Intergenic
962861901 3:139411212-139411234 CTGGCTTCACAGAATGACTTAGG + Intergenic
964104636 3:153025799-153025821 AAGGCTACACAGATTTATTAAGG - Intergenic
967277617 3:187791885-187791907 CTGACTACACAGAATAAATATGG - Intergenic
975204881 4:71634048-71634070 GAGACTACACAAAATTTCTAAGG - Intergenic
977101885 4:92826435-92826457 CATGTTATACAGAAGTACTATGG - Intronic
978941520 4:114441561-114441583 AAGAACACACAGAATTACTAAGG - Intergenic
991155358 5:63428058-63428080 CTGGCTTCACAGAATGACTTGGG + Intergenic
991188827 5:63844256-63844278 TAGGCTGCACAGAATTATCAAGG + Intergenic
992209202 5:74461037-74461059 CAGACTACACAGGAGTCCTATGG + Intergenic
1001267297 5:170283153-170283175 CAGGCTTCACAGTCTTTCTAGGG + Intronic
1006409962 6:33867479-33867501 CAGGTTACAGAGAATGACTCAGG + Intergenic
1009799970 6:68524648-68524670 CTGGCTTCACAGAATTATTTAGG + Intergenic
1011535973 6:88376475-88376497 CAGGCCACAGTGAATAACTAAGG + Intergenic
1012029635 6:94042003-94042025 CAGACTCCACAGAATTAGTTTGG - Intergenic
1013946157 6:115725081-115725103 CAGGCTTCACAGAATGATTTAGG + Intergenic
1014064494 6:117109243-117109265 TAGGCTGCACAGAATTCCTCTGG - Intergenic
1019915881 7:4132245-4132267 CAGGTTACACAGGATTCCGAGGG - Intronic
1020513394 7:9087968-9087990 CTGGCTTCACAGAATTAGTTAGG - Intergenic
1020672567 7:11135771-11135793 CAGGCCACACAGAATTGATTGGG + Intronic
1021866504 7:24963437-24963459 CAGGCAACACAGACTCACCATGG + Intronic
1022125891 7:27357031-27357053 CATGCAACACAGAACTGCTAAGG - Intergenic
1022779288 7:33561983-33562005 CAGACTACATAGAATTGTTAAGG - Intronic
1029282526 7:99445296-99445318 CAGACTACACAAAACTACTGAGG + Intronic
1032579266 7:133088909-133088931 CATGCTACTCAGAATTGCTGGGG - Intergenic
1035834742 8:2737261-2737283 CAGGCTGCACAGAATTATTTCGG + Intergenic
1037093444 8:14952258-14952280 CAGGTTAGACAGTATTACTCTGG + Intronic
1040456448 8:47603238-47603260 CAGGACACAGAGAATCACTAAGG - Intronic
1040626468 8:49155331-49155353 CTGGCTTCACAGAATAACTTAGG + Intergenic
1041147540 8:54893377-54893399 TAGGCTACACAGAGTTAATGAGG + Intergenic
1043095264 8:75961193-75961215 CAGGCAACAAAGTATTACCAGGG - Intergenic
1044699710 8:94954706-94954728 CAGGCTACACAGTGTAACTGAGG + Intronic
1046203992 8:110965162-110965184 CAGGCTTCCTAGAATTGCTATGG - Intergenic
1051057047 9:13000198-13000220 CTTGATACACAGAATAACTAGGG + Intergenic
1051360192 9:16275410-16275432 CAGGCTACACTGCATAACTGCGG + Intronic
1051733489 9:20172834-20172856 CAGGCTTCACAGAATGATTTAGG - Intergenic
1053212900 9:36246415-36246437 CAGGCTACACACAATTGTGAGGG - Exonic
1056886203 9:90446274-90446296 CAGGCCACATGGAATGACTAAGG + Intergenic
1059787118 9:117598004-117598026 CAGGAGACACAGAATATCTAAGG - Intergenic
1186979072 X:14939702-14939724 TTGGCTACACAGAATTACCTGGG - Intergenic
1189650688 X:43186096-43186118 TAGGTTACACATAAATACTAAGG - Intergenic
1189704220 X:43743756-43743778 GAGGTTACACAGAGTTACTTGGG - Intronic
1189977025 X:46472038-46472060 TAGGGTACACAGAATTTCCATGG - Intronic
1190619426 X:52270233-52270255 CAAGCTACACGGAGTTCCTAAGG + Intergenic
1194177541 X:90668934-90668956 CTGGCTACACAGAATGAGTTAGG - Intergenic
1194616256 X:96107253-96107275 CAGGCATCACCGAAATACTATGG - Intergenic
1196224877 X:113154730-113154752 CTGGCTTCACAGAATGACTTAGG + Intergenic
1199501779 X:148515044-148515066 CAGCCTACACTGAATGACTGAGG + Intronic
1200524212 Y:4251081-4251103 CTGGCTACACAGAATGAGTTAGG - Intergenic
1202094596 Y:21235146-21235168 CAGGCTACACAAAATGAGTTTGG + Intergenic