ID: 949178091

View in Genome Browser
Species Human (GRCh38)
Location 3:1091301-1091323
Sequence CTATCTAAAGCACAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949178085_949178091 22 Left 949178085 3:1091256-1091278 CCACAGAGAGAGACAAGTGGGTA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 949178091 3:1091301-1091323 CTATCTAAAGCACAGGTGGATGG 0: 1
1: 0
2: 1
3: 9
4: 152
949178087_949178091 -8 Left 949178087 3:1091286-1091308 CCCTTGAGTAGAAGACTATCTAA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 949178091 3:1091301-1091323 CTATCTAAAGCACAGGTGGATGG 0: 1
1: 0
2: 1
3: 9
4: 152
949178088_949178091 -9 Left 949178088 3:1091287-1091309 CCTTGAGTAGAAGACTATCTAAA 0: 1
1: 0
2: 1
3: 19
4: 152
Right 949178091 3:1091301-1091323 CTATCTAAAGCACAGGTGGATGG 0: 1
1: 0
2: 1
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949178091 Original CRISPR CTATCTAAAGCACAGGTGGA TGG Intergenic
900151531 1:1181095-1181117 CCCTTTAAAGGACAGGTGGAAGG - Intronic
909553827 1:76930519-76930541 CTCTCTCCAGAACAGGTGGAAGG + Intronic
912211044 1:107557233-107557255 CCTTCTAAAGCACTGGTGCAGGG + Intergenic
914750084 1:150529045-150529067 GGATCTAGAGCACAGGTGGAGGG + Intergenic
916149479 1:161772580-161772602 GAATCTAAAGCACATATGGAAGG - Intronic
919776322 1:201196252-201196274 CTTTCTAAAGCCAAGGTGGTGGG - Intronic
920931418 1:210392677-210392699 CTTTGTAAAGCAGAGGTGGGAGG - Intronic
921533855 1:216319914-216319936 CTAACTAAAACACAAGTGTAGGG + Intronic
923882870 1:238122813-238122835 CTGAGTAAAGCACATGTGGATGG - Intergenic
924468732 1:244320906-244320928 GTCTCTAAAACACAGGGGGATGG + Intergenic
1063159679 10:3410123-3410145 CAACCTGAAGCAGAGGTGGAGGG - Intergenic
1064076491 10:12273076-12273098 CTAGATTAGGCACAGGTGGAAGG + Intergenic
1064578454 10:16769551-16769573 CTTGCTAAAACACAGATGGAGGG + Intronic
1067311766 10:45120538-45120560 CTTGCTAAAACACAGATGGAGGG + Intergenic
1070538618 10:77399674-77399696 CTATAAAAAGCACTGGTGAATGG + Intronic
1071817610 10:89248992-89249014 ATGTCTAAATCATAGGTGGAAGG - Intronic
1072989501 10:100178101-100178123 CTATAAAAACCACAGGTAGATGG + Intronic
1073633094 10:105168507-105168529 CTATCTAGAGTACAGTTGGTCGG + Intronic
1074024946 10:109624742-109624764 CAAATTAAAGCACAGGTGTATGG - Intergenic
1074216022 10:111384469-111384491 CTATGTAAAGCCCTGGGGGAGGG + Intergenic
1074540661 10:114362908-114362930 TTATCTATGGCACAGATGGAGGG - Intronic
1077924241 11:6664378-6664400 GAATCTAGAACACAGGTGGAGGG + Intergenic
1078957303 11:16214455-16214477 TTATCTAATGCACAGGTGCTTGG + Intronic
1080789767 11:35511928-35511950 CTCTCAAAAGCTCAGGGGGAGGG - Intronic
1085380833 11:76116347-76116369 CTTTCCAAAGAACAGGTGAAGGG + Intronic
1085507363 11:77067981-77068003 CTCTCTAAACCACAGGTGTAGGG - Intronic
1085802457 11:79602977-79602999 CTGACTAAAGGACAGGTGGTTGG + Intergenic
1089847290 11:121468286-121468308 CTGTCTGAGGCACACGTGGAAGG - Intronic
1090092969 11:123715658-123715680 CGATCAAAAGCACAGGTGAAGGG - Intergenic
1091491570 12:937118-937140 CCATCTAAAGGAAGGGTGGACGG - Intronic
1092962611 12:13610510-13610532 CTGGATGAAGCACAGGTGGAAGG + Intronic
1093470067 12:19491383-19491405 CTAACTAAAGCACAGGGCTATGG - Intronic
1095646773 12:44557163-44557185 CTTTCCAAAGCAGAGGTGGGGGG - Intronic
1096322540 12:50627938-50627960 GGATCTAAAGCATAGGTAGAAGG - Intronic
1096325297 12:50655357-50655379 CTACCTATAGCAAAGGTGGGTGG + Intronic
1097176274 12:57145237-57145259 CTATCAACAGCACAGGGGGCCGG - Exonic
1099233668 12:80056637-80056659 GTTTCCAAAGCACAGGTGGAGGG - Intergenic
1099274826 12:80561424-80561446 ATATCTGAAGCAGAGGTGGCAGG + Intronic
1101272710 12:103164538-103164560 CTGTCTAAGGCACAGGGGGTGGG + Intronic
1101569047 12:105936438-105936460 CTGGATAAAGCAAAGGTGGAAGG + Intergenic
1102949969 12:117024929-117024951 CTATCCTAAGCACAGGCTGATGG + Intronic
1112904901 13:104405292-104405314 ATATCTACAGCACAGCTAGAAGG + Intergenic
1115966789 14:38899149-38899171 CTATCTAAAACAAAGGTGACGGG - Intergenic
1120457283 14:84748169-84748191 ATATCTAGTGCACAAGTGGAGGG - Intergenic
1123539052 15:21269235-21269257 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
1123708440 15:22967625-22967647 CTATCCCAGGCCCAGGTGGAGGG - Intronic
1125006486 15:34823097-34823119 CTATTTAAATCACAAGGGGAAGG - Intergenic
1128608127 15:69053679-69053701 CTATCTCAAACACAGCTGGATGG + Intronic
1129797492 15:78389210-78389232 CTAACTAAAGTACAGAGGGAAGG - Intergenic
1138461460 16:57150687-57150709 CAGTATAAAGCACAGGTGAATGG + Intergenic
1141303022 16:82835681-82835703 CTATCTAGAGAACAGGAGCAGGG - Intronic
1145013452 17:19382452-19382474 CTATCTAAGTCACAGGTGAGAGG + Exonic
1150578202 17:66448779-66448801 TTATCTAAAGCACATTTTGAGGG - Intronic
1151200263 17:72462783-72462805 TTCTCTAAAGCACAAGTTGATGG + Intergenic
1153286060 18:3455351-3455373 ATATTTAAATCACAGATGGACGG - Intronic
1156094985 18:33518779-33518801 CTATCTAAAGAAAAAGTGGTGGG + Intergenic
1156168776 18:34456826-34456848 GTATGTAAGGCACAAGTGGATGG + Intergenic
1156816522 18:41317801-41317823 CTGTCTAAATGCCAGGTGGAAGG - Intergenic
1159624507 18:70676287-70676309 CAATCTAAAGCTCTGGTGCAAGG - Intergenic
1161582499 19:5088477-5088499 CCATCTAGAGCAGAGGTCGATGG + Intronic
1161899866 19:7110339-7110361 AGATCTACGGCACAGGTGGAGGG - Intergenic
1164604395 19:29586925-29586947 TTAGCTAAAACACAGCTGGAGGG + Intergenic
1165101360 19:33440436-33440458 CTGTCCAAAGCAGAGATGGAGGG - Intronic
926975013 2:18506181-18506203 TTATCTAGATCACAGGTGAAAGG + Intergenic
927149852 2:20189237-20189259 CAGTATAAAGAACAGGTGGAGGG - Intergenic
928034602 2:27810264-27810286 GTGTCTAAGGCACAGGTGGTAGG + Intronic
929471472 2:42198355-42198377 CACTCTAAAGCACTGGGGGAAGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
935039083 2:99408457-99408479 CCAGCTAAAGCACAAGTGAATGG + Intronic
935868285 2:107416219-107416241 CTATCCAAAGGCCAGGAGGAAGG - Intergenic
938070653 2:128306602-128306624 CTTTCTAATTCTCAGGTGGATGG + Intronic
940297724 2:152145839-152145861 CTATGTAAAGAACCGGTTGATGG - Intronic
941084866 2:161105451-161105473 CTATCAAAGTCACAGGTGTAGGG + Intergenic
941396301 2:164977913-164977935 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
944256507 2:197628064-197628086 ACATCTAAAGCACATGGGGAGGG - Intronic
945965267 2:216180212-216180234 GGATCTAGGGCACAGGTGGAAGG + Intronic
946819021 2:223611207-223611229 CTATCATAAGCCCAGGAGGAAGG - Intergenic
1170244633 20:14207084-14207106 GAATCAAAAGCACAGGTAGAAGG + Intronic
1173082664 20:39884201-39884223 GCATCTAGAGCACAGGTGGGTGG + Intergenic
1173389707 20:42621196-42621218 CGATCTAGAGCCCAGGGGGAAGG - Intronic
1174647948 20:52102283-52102305 CTACTTAAAACACAGGTGGCAGG + Intronic
1175650176 20:60715134-60715156 CTTTGGAAAGCAGAGGTGGAAGG - Intergenic
1177355524 21:20001417-20001439 CTAGCAAAAGCACAGCTGAAGGG - Intergenic
1177756702 21:25357264-25357286 GGATCCAAGGCACAGGTGGATGG - Intergenic
1178230815 21:30782084-30782106 CCATCAGAAGCACAGGTGAATGG + Intergenic
1178481404 21:32982637-32982659 CCATATAAAGCAAGGGTGGAGGG + Intergenic
1179268003 21:39822385-39822407 ATATCCAAGGCACAGTTGGAGGG - Intergenic
1181738483 22:24900888-24900910 CTATTTAAGACCCAGGTGGAAGG + Intronic
949178091 3:1091301-1091323 CTATCTAAAGCACAGGTGGATGG + Intergenic
952100388 3:30005171-30005193 CTATGTAAAACACCAGTGGAAGG - Intronic
952144948 3:30522214-30522236 CTATCTACAGTACTGTTGGAAGG - Intergenic
954860061 3:53680481-53680503 CAACCCAGAGCACAGGTGGAGGG - Intronic
954951953 3:54482858-54482880 CTATCTAAAGTACAGGAGAGGGG - Intronic
955398346 3:58573383-58573405 CTCAATAAAGCACAGGTGGCAGG + Intronic
956879137 3:73492474-73492496 TTATCCAAAGCACACGTGAAGGG + Intronic
958161984 3:89829121-89829143 CTACCTATACAACAGGTGGATGG - Intergenic
960260128 3:115557885-115557907 GTATCTAAAGTACAAGTGGAAGG + Intergenic
961556534 3:127700033-127700055 GGCTCTAAAGCCCAGGTGGAAGG - Intronic
961960136 3:130845973-130845995 CTTGTTAAAGCACAGGTGGCTGG - Intergenic
962826285 3:139103069-139103091 CCATCTCAAGGTCAGGTGGAGGG - Intronic
964024686 3:152058186-152058208 CAATCTAAAATACAGGTTGAGGG - Intergenic
964975659 3:162616127-162616149 GTATCTAAATCACAGGGTGATGG - Intergenic
967315501 3:188148902-188148924 CTATCACAAGAACAGGTGGGGGG + Intergenic
967605702 3:191443087-191443109 CGATTTAAAGCACAGGTTAAAGG + Intergenic
967605789 3:191444816-191444838 CAATCTAAAGGAAATGTGGAGGG + Intergenic
967890620 3:194361814-194361836 CTAGATGAAGCACAGGTGAAAGG - Intronic
969170575 4:5359411-5359433 CTATTGAGTGCACAGGTGGATGG - Intronic
969283765 4:6189794-6189816 GGATCTTAAGCACAAGTGGATGG + Intronic
972728662 4:41771415-41771437 GTATCTAAAGCAGAGGAGGAGGG - Intergenic
974333373 4:60507810-60507832 ATATTTAAAGCACAGAAGGAAGG + Intergenic
975182978 4:71368610-71368632 CTTTGTAAAGCACAGGGGGCAGG - Intronic
977201066 4:94117082-94117104 CTATCTATAGGACAGGTTTAAGG - Intergenic
978880807 4:113700497-113700519 CTATTTAAAGCTAAGGAGGAGGG - Intronic
980395780 4:132213364-132213386 CTTTATAATGCACAGGTGTATGG + Intergenic
981802322 4:148672745-148672767 CATTCAAAAGCACAGGTGCAAGG - Intergenic
984241321 4:177223057-177223079 CTATTTCAAGCTCTGGTGGAGGG + Intergenic
985275173 4:188231196-188231218 CAATCTAGAGGACAGGAGGAGGG + Intergenic
985985906 5:3516077-3516099 CTATGTACATCACAGGTGAAAGG + Intergenic
986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG + Intergenic
986822528 5:11483084-11483106 CTATCAAAGGCAGAAGTGGATGG + Intronic
989295970 5:39827028-39827050 TTATTTAAAGTACAGGAGGAAGG - Intergenic
990140624 5:52699074-52699096 CTATCTTAAACACAGCTGAATGG - Intergenic
990788535 5:59450805-59450827 AGAACCAAAGCACAGGTGGAAGG - Intronic
990957440 5:61357461-61357483 CTACCTAAAGAAGAGATGGAAGG + Intronic
992072967 5:73165583-73165605 CTATCTGAAGCAGAAATGGAGGG - Intergenic
993561158 5:89411307-89411329 CTATCAATAGAACAGATGGATGG - Intergenic
995222713 5:109668902-109668924 CTATCTAAGGAACAGGGGGAAGG - Intergenic
997192194 5:131947552-131947574 CTTTCTAAAGAACAGATGGTAGG + Intronic
998593230 5:143499994-143500016 GTATCTAACTTACAGGTGGAAGG + Intergenic
1004114668 6:12754544-12754566 CTATATATAGCACAGAAGGAGGG - Intronic
1004561662 6:16758774-16758796 CTACATAAAGCAGAGGTTGAAGG - Intronic
1009901910 6:69818216-69818238 CTTTCTGAAGCACAGGTGAGTGG - Intergenic
1011402816 6:86982285-86982307 TTATCTAAAGCACATTTAGAAGG - Intronic
1016563156 6:145419407-145419429 ATATTTAAAGCACAGGCAGATGG + Intergenic
1018303949 6:162434380-162434402 CTTTGTAAAGCACAGAAGGATGG - Intronic
1021816348 7:24451148-24451170 CGAACTGAAACACAGGTGGAGGG - Intergenic
1033460081 7:141538898-141538920 CCATCCCAAGCACGGGTGGATGG + Intergenic
1034821426 7:154220012-154220034 GAATATAAAGCACAGGTGAAAGG - Intronic
1038046658 8:23771435-23771457 GTCTCTAAAGCAAAAGTGGATGG + Intergenic
1039303983 8:36241306-36241328 CTTGTTAAAGCACAGGTGGCTGG + Intergenic
1040422005 8:47249661-47249683 CTATCAAAATCCCAGGGGGAGGG - Intergenic
1041811912 8:61921254-61921276 CCATCTAAAGCACAAGTGGAGGG - Intergenic
1041823278 8:62063534-62063556 CCATCACAAGCACAGGGGGATGG + Intergenic
1043828365 8:84957240-84957262 ATATCTAAATGACAGGTTGATGG + Intergenic
1043971307 8:86531703-86531725 CAATGAAAAGCCCAGGTGGAAGG - Intronic
1045440314 8:102202387-102202409 TGATGGAAAGCACAGGTGGAGGG - Intergenic
1047313439 8:123711339-123711361 ACATCCAAAGCACAGATGGAAGG - Intronic
1049769930 8:144375032-144375054 CTATAAATAGCACAGATGGACGG + Intronic
1049787574 8:144458366-144458388 GTATCTAAAACACAGGAGCAAGG - Intronic
1051685606 9:19655205-19655227 CTACCAAAACAACAGGTGGATGG - Intronic
1052524239 9:29592892-29592914 CTATCTAAAGGTCATTTGGAGGG + Intergenic
1055466233 9:76569476-76569498 GTATCTAACGCACAAGTGGCAGG + Intergenic
1058825044 9:108767833-108767855 GTGTCTAAAACACAGGTGTATGG - Intergenic
1188781086 X:34286228-34286250 CTATCTTAAGCAAAGGTAGCTGG + Intergenic
1190101014 X:47523350-47523372 CTATCAAAAGAAGAGGAGGATGG + Intergenic
1193023027 X:76813213-76813235 ATATCTACAGCACAAGTGGAGGG - Intergenic
1193851891 X:86547061-86547083 GTATCTAATTCACAGGTGCATGG - Intronic
1193974122 X:88096679-88096701 CCATCTACAGCCCAGGTGGTTGG - Intergenic
1194056404 X:89139292-89139314 GTATCTAAAGAACAGGTGTGTGG + Intergenic
1196764040 X:119226810-119226832 AAATCGAAAGAACAGGTGGAAGG - Intergenic
1198382818 X:136100198-136100220 CTTTATGAAGCAGAGGTGGAAGG + Intergenic
1198464629 X:136893784-136893806 TTATCTGAAGCACAAGTAGAAGG - Intergenic
1198522100 X:137463388-137463410 CCATCTGAAGCACAGCAGGAAGG - Intergenic