ID: 949183698

View in Genome Browser
Species Human (GRCh38)
Location 3:1165760-1165782
Sequence GTGACTTACTCAAGATAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 10, 3: 79, 4: 401}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949183696_949183698 14 Left 949183696 3:1165723-1165745 CCATTTGTAATGAAGAAATCAAA 0: 1
1: 0
2: 5
3: 62
4: 681
Right 949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG 0: 1
1: 0
2: 10
3: 79
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949183698 Original CRISPR GTGACTTACTCAAGATAACA TGG Intronic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901112829 1:6812207-6812229 GTGATTTCCACAAGAAAACACGG - Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
907156669 1:52341258-52341280 TTAACTTGCTCAAGATTACAAGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
913277898 1:117157230-117157252 ATGACTTACTGAAGGTTACATGG - Intronic
915459901 1:156063774-156063796 ATGACTTGCCCAAGATAACAGGG - Intronic
915525030 1:156470670-156470692 GTAACTTACCCAAGGTCACATGG - Intronic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
916610967 1:166391115-166391137 CTGACTTTTTCAAGATCACATGG - Intergenic
917733492 1:177899462-177899484 GTAACTTACCCAAGGTTACAAGG + Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
918987130 1:191646315-191646337 GTGTCTTACTAAAAATAAAAGGG + Intergenic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
923641560 1:235766605-235766627 GTAACTTACCTAAGATCACATGG - Intronic
1062947189 10:1470509-1470531 ATGACTAACTCAAAATAACAAGG + Intronic
1063170322 10:3504001-3504023 GTGACTTGCTCAAAATAATACGG - Intergenic
1063454312 10:6172554-6172576 GTGACTTATCCAAGACCACAGGG + Intronic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1065837549 10:29672769-29672791 GTGAGTAGCTCAAGAGAACATGG - Intronic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1067915144 10:50389502-50389524 GTGTTTTACTTAAGATCACAAGG + Intronic
1067966088 10:50914381-50914403 ATGAGATACTCAAGGTAACATGG - Intergenic
1068042557 10:51843906-51843928 GTGACTGAGTCAAGAAAAGAAGG + Intronic
1068625003 10:59234385-59234407 GTGACTCATTCAAGATTTCATGG + Exonic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070743200 10:78916155-78916177 GTGAGTTACCCAAGGTCACAGGG + Intergenic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1070802117 10:79249935-79249957 GTGACTTACTCAAAGTCACCTGG - Intronic
1071382977 10:85088261-85088283 TTAACTTACACAAGATTACAAGG + Intergenic
1072159301 10:92751524-92751546 GAGACTTACTTAAGGTCACATGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072569775 10:96648433-96648455 GTGACTTACCCAACGTCACAAGG + Intronic
1073044923 10:100631470-100631492 GTGACTTACCAAAGGTCACATGG + Intergenic
1074129804 10:110563947-110563969 GTGACTTTCTGTAGATAAAATGG - Intergenic
1074672518 10:115808907-115808929 TTGCCTAACTCAAGGTAACAAGG + Intronic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1074993260 10:118731302-118731324 GTGACTTCCTCAAGAACTCAAGG + Intronic
1075756824 10:124818840-124818862 GTGACTTCCTCCAAATCACAGGG - Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1079937955 11:26641316-26641338 GTGACTTGCTAAAAATCACACGG + Intronic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083403384 11:62440197-62440219 GTGGCTTTCTCAAGCTCACAGGG + Intronic
1083870690 11:65486524-65486546 GTGACTTGCTGGAGGTAACAGGG + Intergenic
1084865377 11:72051921-72051943 GTGACTTACTGAAGAGAAGTGGG + Intronic
1085372528 11:76022651-76022673 GAGACTTATTCTAGATAAAAAGG - Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085781438 11:79412516-79412538 GTGACTTATCCAAGGTCACATGG - Intronic
1085803781 11:79615869-79615891 GTAACTTACCCAAGAACACATGG - Intergenic
1085821577 11:79799217-79799239 GTAACTTAGTCAAGATCACATGG + Intergenic
1087695711 11:101373500-101373522 ATGACTTACTCAAAGTACCACGG + Intergenic
1088247891 11:107837140-107837162 GTGACTTAGTGAAGAACACAGGG + Intronic
1088415079 11:109579829-109579851 GGGACTTACTCAGAATTACAGGG - Intergenic
1088455244 11:110026604-110026626 GTTGCTTGCTGAAGATAACATGG + Intergenic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091600906 12:1917155-1917177 GTGACTTCCCCAAGTTCACAAGG - Intronic
1091641824 12:2242951-2242973 GTGACTTACCCACGATCATAGGG + Intronic
1092317804 12:7438422-7438444 GTGGTATACTCAAGACAACAGGG + Intronic
1093417655 12:18938579-18938601 TTAACTTACTCAAGATGATATGG - Intergenic
1093535435 12:20217677-20217699 GTGGGTTAGTGAAGATAACAGGG + Intergenic
1095146476 12:38734605-38734627 CTGACTGACTCAAGACAACATGG - Intronic
1096089859 12:48891607-48891629 GTCACTCACTCAAGGTTACATGG - Intergenic
1096198404 12:49663829-49663851 AAGACTTAATCAAGAAAACAAGG + Intronic
1097476417 12:60062079-60062101 GTGACTTACAAAAGTTAACCTGG + Intergenic
1098154821 12:67587078-67587100 ATGAATTACCCCAGATAACATGG + Intergenic
1098708685 12:73725556-73725578 GTGACTAAATTAAGATACCATGG - Intergenic
1099155214 12:79166855-79166877 ATGATTTACTCAAAATAACATGG - Intronic
1099979878 12:89586200-89586222 GTAACTTACTCTAGGTCACATGG - Intergenic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1102511619 12:113419424-113419446 GTGACTTACAAAAGGTCACAGGG + Intronic
1102607445 12:114079197-114079219 GAGACTTACTAAAGATGCCAAGG - Intergenic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102972114 12:117177150-117177172 GGGATTTACTCAAGGTCACAGGG + Intronic
1102980562 12:117237734-117237756 GTGAACTGCTCAAGGTAACAAGG + Intronic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103182407 12:118925050-118925072 GTGACTCACTCAGGATGAGAGGG - Intergenic
1103187853 12:118976928-118976950 GAGATTTACCCAAGGTAACATGG + Intergenic
1103987064 12:124774452-124774474 GTGACTTCCTTATGAAAACAAGG + Intergenic
1104166128 12:126231319-126231341 GTGACTTACTCATTACTACAGGG - Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1105354612 13:19647625-19647647 GTGGTATACTCAAGACAACAGGG - Intronic
1106567802 13:30901412-30901434 GAAACTTGCTCAAGATGACATGG + Intergenic
1108615367 13:52127725-52127747 GTGACTTACCCGAGAATACAGGG - Intronic
1111213909 13:85118472-85118494 AAGACTTACTCAAGATAAAATGG + Intergenic
1112686192 13:101830587-101830609 GTGACTTACTTAGGATCAAAGGG - Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115446271 14:33493819-33493841 GTCACTCACTAAAGATAAAAAGG + Intronic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1116799000 14:49423205-49423227 ATAACTTACTCAAGGTCACATGG - Intergenic
1117015921 14:51516601-51516623 TTTACATACTCAAGATGACAGGG - Intronic
1117387049 14:55225962-55225984 GTTACACACTCAAGATCACATGG - Intergenic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1118208809 14:63748165-63748187 GTTACTAACTTAGGATAACAAGG + Intergenic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1118922492 14:70162344-70162366 GTAACTTATCCAAGATTACATGG - Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120102464 14:80461124-80461146 GTGACTTGCTCAGGGTGACAGGG + Intergenic
1120737302 14:88067087-88067109 GTGACTTGCTCAAGATTACTAGG - Intergenic
1120786136 14:88538775-88538797 GTGACTTGCTCATGGTTACATGG - Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121691139 14:95877598-95877620 ATGACTTAATCAAGGTCACAAGG + Intergenic
1121812879 14:96907169-96907191 GTGACTTGCACAAGGTTACAAGG + Intronic
1121855749 14:97268705-97268727 GTGGCTTACTCAAGTTTGCACGG + Intergenic
1122016413 14:98800575-98800597 GTGACTTGTTCAAGATCTCAAGG - Intergenic
1122024849 14:98868192-98868214 GTGACTTTCTCAAGATCATGTGG - Intergenic
1122734634 14:103830510-103830532 GTAACTCACCCAAGATTACAGGG + Intronic
1123506922 15:20951645-20951667 GTGATTGACTCAACATCACACGG - Intergenic
1123564151 15:21525397-21525419 GTGATTGACTCAACATCACACGG - Intergenic
1123600405 15:21962681-21962703 GTGATTGACTCAACATCACACGG - Intergenic
1125173485 15:36793422-36793444 GTGACTTGCTTAAGATAACACGG - Intronic
1126579040 15:50226112-50226134 GTCACTTGATCAAGATAAGAAGG - Intronic
1126582718 15:50255959-50255981 GGGACTAACTCAAGTTCACATGG + Intronic
1126737831 15:51750154-51750176 GTGACTTATTCAAGGTCATAGGG - Intronic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1129276294 15:74447871-74447893 GTGACATACTCAAAACTACAAGG - Intronic
1129455236 15:75673258-75673280 GAGACTTGCTCCAGATATCAGGG + Intergenic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1130236883 15:82143834-82143856 GTGACACAGTCAAGATAACTGGG + Intronic
1130719726 15:86374823-86374845 GTGACTGGCTCAAGATAATATGG - Intronic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1131623482 15:94092570-94092592 GTGACTTTATCTATATAACAAGG - Intergenic
1131828203 15:96336606-96336628 GTGTTTTCCTGAAGATAACAGGG + Intronic
1202972510 15_KI270727v1_random:252493-252515 GTGATTGACTCAACATCACACGG - Intergenic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1138427046 16:56942064-56942086 GAGACTTACTCAAGAATCCAAGG - Intronic
1139126123 16:64079770-64079792 GTGACTATCTCAGGAAAACAAGG - Intergenic
1140333248 16:74078338-74078360 GTAACTAACTCAAGTTAACGAGG - Intergenic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1140961805 16:79920535-79920557 CTGACTTACACAAAATAACAGGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1143982120 17:10879192-10879214 GTGACTTCCTCAAGGTCGCATGG - Intergenic
1145803448 17:27707435-27707457 GTGAAATACTCAAGAGCACAAGG - Intergenic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146309088 17:31753248-31753270 GTAACTTATTCAAGTTCACATGG - Intergenic
1146413535 17:32610534-32610556 ATGAGTCACTCAAGATCACATGG - Intronic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1148546456 17:48522788-48522810 GTGACTTACCCAAGGACACAAGG + Intergenic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1150645181 17:66973463-66973485 GTGACTTACGCAAGGTGGCATGG + Intronic
1150690517 17:67362767-67362789 GTGTTTTACTCAAGGTAATATGG - Intronic
1150937123 17:69648757-69648779 GTTTCTTACTCAAGATCATATGG + Intergenic
1151190675 17:72395621-72395643 GTCACTCACTCAAGGTTACACGG + Intergenic
1151495904 17:74457913-74457935 GTGACTCTCTCAGGATAACAAGG + Intergenic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1155319147 18:24601793-24601815 GTGACTCACTCAGGATCACGTGG + Intergenic
1155353202 18:24926622-24926644 TTGCCTTGCTCAAGATACCAGGG - Intergenic
1155494854 18:26432833-26432855 GTGACTTATTCATGGTTACATGG - Intergenic
1156458734 18:37309284-37309306 GTGACTTCCTCAACAACACATGG - Intronic
1157100320 18:44723461-44723483 GTGATTTGTTCAAGATCACATGG + Intronic
1157485529 18:48084347-48084369 GAAACTTACTCAAAACAACAGGG - Intronic
1158021535 18:52847840-52847862 GTGACCTACTCAAAGTTACAAGG - Intronic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1162556208 19:11387560-11387582 GTAACTTACTCAAGGTCCCATGG - Intronic
1163174622 19:15555803-15555825 GTGACTTACCCAAGATCATTCGG + Intergenic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1165704531 19:37966345-37966367 GTGACTTGCTCATGATGGCAAGG + Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
925581562 2:5416502-5416524 GTGACTAACTCAGGTTACCAAGG - Intergenic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
928073624 2:28242398-28242420 CTGACTTACTTAAGGAAACAGGG - Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928395250 2:30938760-30938782 GTGACCTACTCAATAGCACATGG - Intronic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930131274 2:47853591-47853613 GGTACTTATGCAAGATAACAGGG - Intronic
930737846 2:54797793-54797815 GTAACTTGCCCAAGATTACATGG - Intronic
930883392 2:56297288-56297310 GAAACTTACTCAAAATATCAGGG + Intronic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
931816039 2:65901688-65901710 CTGACTTACTCAGGATTGCATGG - Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932450804 2:71809553-71809575 ATGCCCAACTCAAGATAACATGG + Intergenic
932476860 2:72011722-72011744 GTAACTTACCCAAGTTCACATGG - Intergenic
933693146 2:85195132-85195154 GTAACTTGCTCAAGGTTACAAGG - Intronic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936373041 2:111919055-111919077 GTGACTTACACAAGGTCACCTGG + Intronic
938954453 2:136285078-136285100 TTTACTTAATCAAGATAACCGGG + Intergenic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
942999808 2:182312369-182312391 TTGCCTAACTCAAGATCACAAGG + Intronic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
945304050 2:208241807-208241829 ATGATTTACTCAAGACCACATGG - Intronic
945540433 2:211079930-211079952 AAGACTTACCCAAGAAAACAAGG + Intergenic
945603789 2:211901211-211901233 GTGACTTATTCAAGGTTACAGGG - Intronic
945891893 2:215438339-215438361 GTTTCTTAGTTAAGATAACAGGG + Intergenic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
947079822 2:226383594-226383616 GTAACTCACTCAAGATCTCATGG - Intergenic
1168734444 20:118256-118278 ATGACTAATTCAATATAACAAGG + Intergenic
1168796722 20:615072-615094 GTAAATGACTCAAGAGAACAAGG - Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168997600 20:2144777-2144799 GTGACTTTGCCATGATAACAGGG + Exonic
1170585361 20:17730265-17730287 GTGGATTGCTCAAGATCACATGG + Intronic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1172282665 20:33719290-33719312 ATGACTTCCTCCAGATCACACGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172810668 20:37645608-37645630 GTGAGTTACTCAAGGTCGCATGG - Intergenic
1172855791 20:38001315-38001337 TTAACTTACTCAAGGTCACATGG + Intronic
1173759409 20:45546621-45546643 GTAACTTGCCCAAGATTACAGGG + Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1173954336 20:47019043-47019065 GTCACTTACCCAAGGTCACACGG + Intronic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174994544 20:55551170-55551192 GTGACTTACCCAAGGTCACGTGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175307218 20:57984549-57984571 GTGACTTACTTGAGATTACCTGG + Intergenic
1175462767 20:59165480-59165502 GTGACTTATTCCAGGTTACAGGG + Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1176913138 21:14592481-14592503 GTGGCTCACTCAAGTTCACATGG - Exonic
1177406144 21:20670992-20671014 GTGAATTATCCAAGATCACAGGG - Intergenic
1178883860 21:36469516-36469538 GTATCTTACTCAAAATCACACGG + Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179710655 21:43211268-43211290 GTGACTTATCCAAGGTCACAGGG - Intergenic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182763630 22:32742993-32743015 GTAACTTACCCAAAGTAACATGG + Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183741639 22:39671859-39671881 ATGACTTACTCAAGATCATAAGG + Intronic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
951262659 3:20529400-20529422 GAGGATTACACAAGATAACAAGG - Intergenic
951273315 3:20654467-20654489 GTGATTTACCAAAGATTACAAGG + Intergenic
951358744 3:21700595-21700617 GTGAGTTACTGAATATCACAAGG - Intronic
952044876 3:29306324-29306346 TTGAAATACTAAAGATAACATGG - Intronic
952235904 3:31479965-31479987 GTGACTTACTTCAGATAAATGGG + Intergenic
952519185 3:34138247-34138269 GTGACTTATTCAAGCTCATAAGG + Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953750012 3:45601718-45601740 GTGACTTGCTCAAGACCATATGG + Intronic
954169171 3:48786492-48786514 GTACTTTACTCAAGATAACTTGG + Intronic
955091234 3:55752714-55752736 TTAACTTACTCAAGTTTACATGG + Intronic
956109003 3:65852224-65852246 GTGTCTTCCACAAGGTAACAAGG + Intronic
958664984 3:97126004-97126026 GAGACTTATTCAAGATCAAATGG + Intronic
958827436 3:99048709-99048731 GTGACTTAGTCAAGAGCACATGG + Intergenic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960080455 3:113534690-113534712 GAGACTTACTCCAGAGATCATGG - Intronic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
961071325 3:123930626-123930648 CTGACTTACCCAAGATCATATGG + Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961911655 3:130323611-130323633 GTGAATGACCCAAGAGAACAAGG - Intergenic
963318794 3:143789909-143789931 GTAACTCACTCAGGAAAACATGG - Intronic
963900245 3:150726663-150726685 GTTACTTACTCAAGTTTACATGG - Intergenic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
964938871 3:162129672-162129694 GTGACTGACTCAAAGTAGCATGG + Intergenic
965727677 3:171736343-171736365 GTCACTCATTCAAGATCACAAGG + Intronic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966338511 3:178898813-178898835 ATGAATTGCTCAAGATTACATGG - Intergenic
966738918 3:183213742-183213764 TTAACTCACTCAAGATTACATGG - Intronic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967516696 3:190378014-190378036 TTGACTGACTCCAGAGAACATGG - Intronic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
969085117 4:4650783-4650805 GCAGCTTGCTCAAGATAACAAGG + Intergenic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
969956942 4:10900384-10900406 GTGACTTTCTCAATAGAGCATGG - Intergenic
970631501 4:17951973-17951995 ATGAGTTACTCAAGAAAACTGGG + Intronic
970869289 4:20796930-20796952 ATAACTTACTCAAGAGAAAATGG - Intronic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
972425624 4:38929900-38929922 GTGACTTATTCAAGGTTACAAGG - Intronic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973819261 4:54648403-54648425 GTGACTTACTTGAGATCACCTGG - Intergenic
973994433 4:56442825-56442847 GTGCCTTCCACAAAATAACAAGG + Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
974490972 4:62564195-62564217 TTGACTTACTTAAGATCACATGG - Intergenic
974821549 4:67072679-67072701 GTGACTTAGACCAGATAACATGG + Intergenic
975038944 4:69720802-69720824 GTGACTTGCTCAAGTTTTCAGGG + Intergenic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
978674614 4:111296603-111296625 GTGACTTACTGGAAATAAAAGGG - Intergenic
979458963 4:120958518-120958540 GTAACTTACGCAAGGTAACATGG - Intergenic
979709975 4:123767934-123767956 GTTACTTGCTCAGGATTACACGG + Intergenic
980573478 4:134654514-134654536 GTAACTTAATCAAGGAAACATGG - Intergenic
981259501 4:142703013-142703035 GTAACTTGCACAAAATAACATGG - Intronic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981552371 4:145955020-145955042 ATGACTTGCTTAAGATAACCTGG - Intergenic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
982502517 4:156174502-156174524 GGGAGTTCCTCAAGATAAAATGG - Intergenic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
988106191 5:26751934-26751956 GTGACTCAGTCAAGATGAAATGG - Intergenic
989532136 5:42520336-42520358 GGGATTTACACAAGATCACAAGG - Intronic
990007127 5:50956632-50956654 GTAACTTGCACAAGATTACAGGG + Intergenic
992665266 5:79002122-79002144 CTGACTTCCAGAAGATAACATGG + Intronic
994121459 5:96118507-96118529 GTGACCTAATCCAGACAACAAGG - Intergenic
994357597 5:98811450-98811472 ATGACATTCTCAAGAGAACAAGG - Intergenic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
998861621 5:146449455-146449477 GTGACTTACACAAGGTCACTGGG + Intronic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
1000339796 5:160268341-160268363 GTGACTTACCCCAGACCACATGG - Intronic
1000379927 5:160619927-160619949 GTGACTTACAAGAGGTAACATGG - Intronic
1000497146 5:161998788-161998810 GTGTCTTATTCAATATAATAGGG + Intergenic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001336810 5:170804801-170804823 ATAACTTTCTCAGGATAACAAGG - Intronic
1002874178 6:1196756-1196778 GTGACTTAGGCAACATAACCAGG + Intergenic
1004979545 6:21008026-21008048 ATGCCTTACTTAAGATACCAAGG - Intronic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1007466306 6:42053917-42053939 GTGACTTGCTCAGTATAGCAGGG + Intronic
1007637998 6:43311830-43311852 GGAACTTACTCAAGAAAACTCGG - Intronic
1007642716 6:43355534-43355556 ATGACTTGCTCAAGACAATAGGG - Exonic
1008320747 6:50110405-50110427 GTGAGTTACGCAAAATATCAGGG - Intergenic
1008487989 6:52055856-52055878 GTTACTTACTCAAGGTTGCATGG - Intronic
1008886523 6:56437008-56437030 GTGACTAACTGAAGAAAAGAGGG - Intergenic
1010525666 6:76897580-76897602 GTGTCTTAAACAAGATAAAAAGG + Intergenic
1010541015 6:77092295-77092317 TTGACTGACTCAAGTTAAAAAGG + Intergenic
1010932459 6:81819209-81819231 GGGACTGATTCAAGTTAACATGG - Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1011562046 6:88629925-88629947 CTGACTTAATCAAGATTAGAAGG - Intronic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1013089372 6:106885859-106885881 GTGAGTTACTCAAAGAAACACGG + Intergenic
1016276281 6:142356735-142356757 GTGACTACCTCAAGGTCACATGG + Intronic
1017447078 6:154516869-154516891 CTGACTTGCTCAAGGTTACAGGG - Intergenic
1017780401 6:157711205-157711227 GTGACTTACCCAAGGTCACGTGG - Intronic
1018239700 6:161761217-161761239 GTGTCTTTCTCCAGATAAGACGG + Intronic
1018347506 6:162917132-162917154 GCGAGTTTCTCAAAATAACATGG - Intronic
1018358696 6:163044074-163044096 GAGAATCACGCAAGATAACAGGG + Intronic
1018409022 6:163522385-163522407 GTGAGTTGCTCAAGATTACAGGG + Intronic
1019023320 6:168937466-168937488 GTGACTTATTTAAGATAAAGTGG + Intergenic
1020222913 7:6255159-6255181 GTAACTTACACAAAATCACAAGG + Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022303557 7:29125303-29125325 CTGACTTGATCAAGATGACAAGG + Intronic
1022619786 7:31971391-31971413 ATAACTCACTCAAGATCACATGG - Intronic
1022779482 7:33564414-33564436 GTTACTTACTCAAAATCACATGG - Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1024177597 7:46856895-46856917 GTGACTTATCCAAGATGATAGGG - Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1029141921 7:98417449-98417471 GTGACTTACTCCAAGTCACAGGG - Intergenic
1030796090 7:113789831-113789853 GTGAGTTTGTCAAGATCACATGG - Intergenic
1031856489 7:126928750-126928772 GTGACTTACTAAATATAATATGG + Intronic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1031958820 7:127970337-127970359 ATGACTTACACAAGGTCACATGG - Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1033016657 7:137678390-137678412 GAGAGTTTCTCAAGTTAACATGG - Intronic
1033378885 7:140792864-140792886 GTGACTTACTGTTGATTACAAGG - Intronic
1033521610 7:142166627-142166649 GTGATTTCCTCTAGATTACATGG + Intronic
1033799140 7:144880099-144880121 GTAACTTTATCAAGATTACATGG + Intergenic
1034563495 7:151896163-151896185 GTGACTCATTCAAGGTCACAGGG + Intergenic
1034681129 7:152928696-152928718 GTAACTAATTCAAGAAAACAAGG - Intergenic
1035909218 8:3547175-3547197 TTGTCTTACACAAGAAAACAGGG + Intronic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1037723393 8:21463869-21463891 GAGACTTACTCACTATCACAAGG + Intergenic
1038513650 8:28164387-28164409 GAGACTTGCTCAAATTAACAGGG + Intronic
1040016653 8:42705784-42705806 GTGAATTGCTCAAGAGAAGAGGG - Intronic
1040835455 8:51725742-51725764 GTGTCTTACTAAAGAGAACTGGG - Intronic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041414282 8:57590168-57590190 GTGACTTGCTCAAAGTAACATGG - Intergenic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1042636127 8:70877460-70877482 GTGATTTACTCAAGATCACTTGG + Intergenic
1042923327 8:73941109-73941131 GAGACTTACTCACTATCACAAGG - Intronic
1043098461 8:76007057-76007079 GTTACTTACTTAAGATAACTTGG + Intergenic
1043815637 8:84797792-84797814 GTGCCTTACTCAAGCCAGCAAGG - Intronic
1044241258 8:89891511-89891533 GTAACTTAACCAAGATCACATGG + Intergenic
1044800891 8:95954091-95954113 GTCATTTTCTGAAGATAACAGGG - Intergenic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1046398423 8:113672221-113672243 TTAACTTGCTCAAGGTAACATGG - Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048334075 8:133490235-133490257 GTGGCTTACTCCAGGTCACATGG + Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1051839928 9:21384226-21384248 ATGTTGTACTCAAGATAACAAGG - Intergenic
1052027377 9:23588617-23588639 GTGACTTGCTTAAGATAAAATGG + Intergenic
1052036984 9:23693895-23693917 GTGGCTTGCTCAAGACCACAGGG + Intronic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1054754688 9:68945735-68945757 GTAACTTTCTCAAGACCACATGG + Intronic
1054869521 9:70036380-70036402 GTGACTTGCTCAAAAGTACAGGG - Intergenic
1056068948 9:82965930-82965952 GTTATTTACTCAAGGTCACATGG - Intergenic
1056236060 9:84595860-84595882 TGGACTTGCTCAAGATAACATGG - Intergenic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059686569 9:116643026-116643048 ATAATTTACTTAAGATAACATGG - Intronic
1059730982 9:117056662-117056684 GTGCCTTGGTAAAGATAACAAGG - Intronic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1061006293 9:127930161-127930183 GTGACTTACCTAAGGTCACAAGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061291094 9:129650739-129650761 GTGACTAGCCCAAGATGACAAGG + Intergenic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187609697 X:20928863-20928885 GTAACTTACCCAAGGTAACCTGG + Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1188366423 X:29320882-29320904 ATGAGTTACTCAACATAAAATGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189257498 X:39651925-39651947 GGGACTTATTCAAGTTCACAAGG + Intergenic
1189491264 X:41473345-41473367 GTGCCTGACACAAGATAACTCGG + Intronic
1189663852 X:43332178-43332200 GTGACTTTCTTAAGATCTCATGG - Intergenic
1190116726 X:47630170-47630192 GTGACTCACCCAAGGTCACACGG - Exonic
1190969216 X:55332675-55332697 GTAACTTACTCAAGGTCCCATGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192710921 X:73586659-73586681 GTGACTTTCTCAGAATCACATGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1193246054 X:79231678-79231700 GTGTCTTATTCAAGACCACAAGG - Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1195460662 X:105120024-105120046 GTGACTTATCCAAGGTCACATGG + Intronic
1195767353 X:108310306-108310328 GTGATAGACTCAAGAGAACAAGG - Intronic
1195981798 X:110586485-110586507 GTAACTTACTCGAGGTCACATGG - Intergenic
1197752919 X:129977924-129977946 GTGGCTTGCTCAAGATTGCATGG - Intergenic
1197958366 X:131977474-131977496 TTGATTTGCTCAAGATCACATGG + Intergenic
1198781524 X:140242231-140242253 CTTACTTACCAAAGATAACATGG - Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199811445 X:151353774-151353796 GTAACTTACCCAAGGTCACACGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic