ID: 949185230

View in Genome Browser
Species Human (GRCh38)
Location 3:1183251-1183273
Sequence CTGTGAATCCGAAGCTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949185230 Original CRISPR CTGTGAATCCGAAGCTATCA TGG Intronic
901033031 1:6319562-6319584 CTATGAATCCGAAGAGCTCATGG - Intronic
902241110 1:15090060-15090082 CTCTGAATGCGAAGCTATGGGGG - Intronic
911154067 1:94622267-94622289 CTGTCCATCCAAAGCTGTCAAGG - Intergenic
915128568 1:153681818-153681840 ATGTGGAACCGAAGCTTTCAAGG + Exonic
915610024 1:156984381-156984403 CTGTGAAGCCGAAGCCATGCTGG + Exonic
924086170 1:240454162-240454184 CTGTGGATCCGTAGCAATCATGG + Intronic
1062954479 10:1531076-1531098 CTGTGGATCGCCAGCTATCATGG - Intronic
1079387024 11:19989471-19989493 CTGTGAGTCAGAAGCTGACATGG - Intronic
1081200892 11:40214123-40214145 CGGTTAATCAGAAGCTAACATGG - Intronic
1088743799 11:112787700-112787722 CTGTGAATTTGGAGCTATGATGG - Intergenic
1096743573 12:53711613-53711635 CTGTGTATCAGAAGCAACCAGGG + Intronic
1098189616 12:67934437-67934459 CTGTGAAACAGAATCTAGCATGG - Intergenic
1103188380 12:118980842-118980864 CTGTGCATGCGGAGCTGTCAAGG - Intergenic
1111862360 13:93724152-93724174 CAGGGAATCTGAAGCTAGCATGG - Intronic
1115738947 14:36366722-36366744 CTCTGAATCCTAAGCTATGTGGG + Intergenic
1122594738 14:102881964-102881986 CTGTGCATCCTAAGCAACCAGGG - Intronic
1124361446 15:29039411-29039433 CTGTGAATCCTAAGATATGATGG + Intronic
1125638575 15:41210365-41210387 CAGTGAATCCGAGGCTTTAAGGG - Intronic
1126566549 15:50107289-50107311 CTGTGAATCAGAATATCTCAGGG + Intronic
1128371351 15:67041746-67041768 CTGTGATTCCGCATCTATGAAGG - Intergenic
1129407491 15:75328935-75328957 CTGAGAATCCGAAGGCATCCAGG - Intergenic
1129470662 15:75751725-75751747 CTGAGAATCCGAAGGCATCCAGG - Intergenic
1130923180 15:88366016-88366038 CTGAGAAGCCGAAGCATTCAAGG + Intergenic
1130977192 15:88785602-88785624 CTGTGAGGCTGAAGATATCAAGG + Intergenic
1148340400 17:46870162-46870184 CTGTCAATCAGTTGCTATCAGGG + Intronic
1150678152 17:67262664-67262686 CTGGGACACCGAAGCTATTATGG - Intergenic
1152093409 17:78258949-78258971 CTCTGGATCCCAAGCTATCGGGG - Intergenic
1160074029 18:75654844-75654866 CTGTGGATACGAAATTATCAAGG - Intergenic
1160403159 18:78625855-78625877 CTGGGAATGCTAAGCTATCTGGG + Intergenic
926014022 2:9433055-9433077 CTGTGAATTCTAAGACATCAGGG - Intronic
927107744 2:19842352-19842374 CAGTGAATCAGAATCAATCATGG - Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
939644272 2:144677384-144677406 CTTTTCATCCGAAGGTATCAAGG - Intergenic
940467922 2:154056452-154056474 CTATGAGTCTGAAGTTATCATGG - Intronic
1170503419 20:16998649-16998671 ATGTGAATAGGAAGCTAGCAGGG + Intergenic
1179254113 21:39700063-39700085 CTGTGACTCCAAAGCTCTCCAGG - Intergenic
949185230 3:1183251-1183273 CTGTGAATCCGAAGCTATCATGG + Intronic
950213036 3:11137738-11137760 ATGTGAATCTGAAGATAACAGGG - Intronic
953702342 3:45206546-45206568 CGGTTAATCAGAAGCTAACATGG + Intergenic
961334155 3:126160213-126160235 TTCTGAATCCGAAACTCTCAGGG + Intronic
968867745 4:3224715-3224737 CTGTGATTCCGTAGCTATTTAGG + Intronic
970494006 4:16607436-16607458 GTGTGAATCAGAAACTTTCAAGG - Intronic
970747009 4:19311216-19311238 CTGTCATCCTGAAGCTATCAGGG - Intergenic
980873366 4:138635493-138635515 CTGAGAATATGCAGCTATCATGG - Intergenic
985480195 5:105239-105261 CTGTGAATCCACAGCCATGACGG - Intergenic
985716319 5:1463960-1463982 CTGTGAAACGGATGCTTTCAGGG + Intronic
994133741 5:96261602-96261624 CAGTTAATCAGAAGCTAACATGG + Intergenic
996491007 5:124096336-124096358 TTGTGACTCAGAAGCTCTCATGG - Intergenic
1001450180 5:171818617-171818639 CTGTGATTCAGTTGCTATCATGG - Intergenic
1003524265 6:6885098-6885120 CTGAGAATCAGAAAATATCAGGG + Intergenic
1016742134 6:147540157-147540179 CTGCGAATCAGAAGCTAATAGGG + Intronic
1017990810 6:159488418-159488440 CTGTGAATCCTACTCCATCAAGG + Intergenic
1023158070 7:37271580-37271602 TTGTGAATTCAAAGCTATCCTGG + Intronic
1027748998 7:82117303-82117325 TTGTGTATCCAATGCTATCAAGG - Intronic
1031337305 7:120551667-120551689 CTATAAATCCGAACCTCTCATGG - Intronic
1034417060 7:150970796-150970818 CTGTGGCACTGAAGCTATCAGGG - Intronic
1046567674 8:115921579-115921601 CTGAGGATCTTAAGCTATCAAGG - Intergenic
1059808769 9:117833018-117833040 CCATCAATCCAAAGCTATCATGG + Intergenic
1061224196 9:129271194-129271216 CTGTGAATTGGAAGTTTTCAGGG - Intergenic
1196762772 X:119214509-119214531 CTTTGAATGCCAGGCTATCAGGG + Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic