ID: 949185912

View in Genome Browser
Species Human (GRCh38)
Location 3:1191309-1191331
Sequence CCAAGCTGTTAGTAGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949185906_949185912 16 Left 949185906 3:1191270-1191292 CCTGGATAGCTTCAGAATGGGAG 0: 1
1: 5
2: 36
3: 154
4: 462
Right 949185912 3:1191309-1191331 CCAAGCTGTTAGTAGAAGCTTGG 0: 1
1: 0
2: 3
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949185912 Original CRISPR CCAAGCTGTTAGTAGAAGCT TGG Intronic
907833145 1:58084538-58084560 CCAATCTCTAAGCAGAAGCTGGG + Intronic
910241422 1:85090751-85090773 CTAAGCTGTTAGTAGGACCCTGG + Intronic
911259155 1:95666110-95666132 CCAAGCCATGACTAGAAGCTTGG - Intergenic
913331010 1:117667778-117667800 CCAAGGGGTGAGTAGAAGTTGGG - Intergenic
915868166 1:159528207-159528229 CAATGGTGTTAGTAGAAGTTGGG + Intergenic
920735163 1:208526949-208526971 TCAAGCTGTCAGTAGAAGGCAGG + Intergenic
921362102 1:214339791-214339813 CCAAGCCTTAATTAGAAGCTTGG - Intergenic
921476517 1:215616923-215616945 CCAAGATGGGAGTAGAAGGTTGG + Intronic
922229345 1:223672250-223672272 CCAAGCCATGATTAGAAGCTTGG + Intergenic
922512424 1:226180246-226180268 CTAAGCAGTTAGTATATGCTAGG - Intronic
923074605 1:230598540-230598562 CCAAGTTGTGATTAGAATCTTGG - Intergenic
1064337744 10:14458853-14458875 CCAGGCAGATAGTGGAAGCTGGG + Intronic
1064727100 10:18291320-18291342 CCAAGCTTTAATAAGAAGCTTGG - Intronic
1064805758 10:19129586-19129608 TCAAGCTATGATTAGAAGCTTGG - Intronic
1065132959 10:22641263-22641285 GCAGGCTGTGGGTAGAAGCTAGG - Intronic
1069754560 10:70765649-70765671 ACATGCTGTTAGAAGTAGCTAGG - Intergenic
1071017307 10:81012688-81012710 CCAAGTTATAATTAGAAGCTTGG - Intergenic
1071962797 10:90823168-90823190 GCAAGCTGTTGGTAGATTCTGGG - Intronic
1075308421 10:121389887-121389909 TCAAGCTGATAGTAGAAGGTGGG + Intergenic
1078324069 11:10365041-10365063 CCAAGCCATGATTAGAAGCTTGG + Intronic
1079997952 11:27316229-27316251 CCAAGATGTTAGGAGAATCCAGG - Intergenic
1080052061 11:27868323-27868345 CCAAGCCATGATTAGAAGCTTGG - Intergenic
1080060961 11:27956244-27956266 TCAGGCTGTTAATAGAAGCAAGG + Intergenic
1080302881 11:30804182-30804204 CCAAGCCATGATTAGAAGCTTGG + Intergenic
1080568322 11:33532850-33532872 CCAAGGTGTCAGTATAAGCATGG - Intergenic
1081028427 11:38045825-38045847 CCAATCTGTTTGTAAAACCTAGG - Intergenic
1083057922 11:59841054-59841076 CAGAGATGTTAGTAGAAGCCTGG + Intronic
1083196169 11:61089927-61089949 TCAATCTGTCAGTTGAAGCTTGG - Intergenic
1085625379 11:78067864-78067886 CCAAGCTGTTAAGAGGAGCGAGG - Exonic
1087613625 11:100463552-100463574 CCCAGCTTTTAGTTGAAGCAGGG - Intergenic
1087663817 11:101019265-101019287 CCAAACTGTGATTAGAAACTTGG + Intergenic
1088572579 11:111237523-111237545 CTAACTTGTTTGTAGAAGCTGGG + Intergenic
1088880373 11:113968952-113968974 GCAAGCTGGTAGCAAAAGCTAGG - Intergenic
1092807395 12:12237012-12237034 CCAAGCCATGATTAGAAGCTTGG - Intronic
1095884643 12:47176413-47176435 CCAAGCCATGATTAGAAGCTTGG + Intronic
1097142543 12:56914852-56914874 CTAAGCTGTTAATAGAACCTTGG + Intergenic
1098909688 12:76196239-76196261 CCAAGCCATTATTAGAAGCTTGG - Intergenic
1100595794 12:96070935-96070957 CAAACCTGTTAGTATGAGCTTGG - Intergenic
1101505524 12:105342642-105342664 CCAAGCCTTGATTAGAAGCTTGG - Intronic
1102934430 12:116884548-116884570 CTAAACTGTTAGGAGAAGCTTGG - Intergenic
1106392493 13:29348152-29348174 CCAAGCCATGATTAGAAGCTTGG - Intronic
1108241955 13:48474271-48474293 CCAAGTCTTGAGTAGAAGCTTGG - Intronic
1109030405 13:57182158-57182180 CCAACCTCTTAGTTGTAGCTGGG - Intergenic
1110609101 13:77469382-77469404 CCAAGATGATAGTAAAAGATAGG + Intergenic
1111067811 13:83120757-83120779 CCAAGCCATGATTAGAAGCTTGG + Intergenic
1114594604 14:23900608-23900630 CCAAGCCGTGGTTAGAAGCTTGG + Intergenic
1114951386 14:27759006-27759028 CCAATCTGTTGGAAAAAGCTTGG - Intergenic
1116711933 14:48379232-48379254 TCAAGCTGTTGGTTGTAGCTGGG + Intergenic
1119264194 14:73254481-73254503 CAAGGCTGTCAGCAGAAGCTCGG - Intronic
1122024738 14:98867584-98867606 CCAAGCTGTGTGTTGGAGCTGGG - Intergenic
1124192688 15:27594283-27594305 CCAAGCCGTGATTAGAAGCTTGG - Intergenic
1126337830 15:47605990-47606012 CCAAGCCTTCATTAGAAGCTTGG - Intronic
1128633888 15:69290731-69290753 CCAAGCTCTTGCTACAAGCTAGG - Intergenic
1133923008 16:10171201-10171223 CAAAGCTGTAACTAGAACCTAGG - Intronic
1136034187 16:27526302-27526324 CCAAGCTGGGAGCAGCAGCTGGG + Intronic
1150176583 17:63063383-63063405 CCAAGCCATGATTAGAAGCTAGG - Intronic
1153770815 18:8415220-8415242 CCAAGCTGTTGAGAGCAGCTAGG + Intergenic
1154128562 18:11715775-11715797 CCAAGCAGCCAGTAGAAGCTGGG + Intronic
1155151574 18:23127511-23127533 CCAAGCCATGACTAGAAGCTTGG + Intergenic
1155788571 18:29933736-29933758 CCAAACTTTGATTAGAAGCTTGG - Intergenic
1156213013 18:34967478-34967500 CCAAGCTATGATTAGAAGATTGG - Intergenic
1157885854 18:51365628-51365650 CCAAGCCATAATTAGAAGCTTGG + Intergenic
1158260028 18:55596295-55596317 CTGAGCTGTAAGCAGAAGCTTGG + Intronic
1161665386 19:5572926-5572948 TTAAGCTGTTAGGAAAAGCTCGG + Intergenic
1163541152 19:17911392-17911414 CCAAGCCATCATTAGAAGCTTGG - Intergenic
1164296028 19:23910860-23910882 CAAAGCTGTTCATAGAAGTTTGG - Intergenic
1165106653 19:33474045-33474067 CCAAGCTGCTAGCAGAAGCTGGG + Intronic
925273774 2:2634722-2634744 CCATGCTGTTAGTTGGAGTTGGG + Intergenic
930009275 2:46923310-46923332 CCAAGGTGTGATTAGAAGGTTGG - Intronic
930147020 2:48017676-48017698 ACTAGCTGTGAGAAGAAGCTGGG + Intergenic
930252117 2:49046119-49046141 CCAACCTTTAAGTAGCAGCTGGG - Intronic
931438943 2:62273653-62273675 CCAAGCCATGATTAGAAGCTTGG + Intergenic
932431376 2:71675757-71675779 CCAAAATGTTAGTAGAAATTGGG - Intronic
932802156 2:74750476-74750498 CCAAGCCGTGATTAGAAGCTTGG - Intergenic
934485958 2:94710695-94710717 CCAATCTGTTGGAAAAAGCTTGG + Intergenic
936061518 2:109298160-109298182 CCCAGCTGGTAGAAGTAGCTGGG + Intronic
936820691 2:116517219-116517241 CAAAGCTGTTACTTCAAGCTTGG - Intergenic
937356988 2:121203991-121204013 CCAAGCCCTGATTAGAAGCTTGG + Intergenic
937600649 2:123727447-123727469 TCAAGCTGTTCGTGGAAGCAAGG + Intergenic
939608607 2:144282787-144282809 CCAAGCCGTGATTAGAAGCTTGG + Intronic
939617632 2:144378663-144378685 GCCAGCTGTTACCAGAAGCTAGG - Intergenic
940692220 2:156933633-156933655 CCAAGCCTTGATTAGAAGCTTGG + Intergenic
941216064 2:162710803-162710825 CCAAGTTTTCAGGAGAAGCTGGG + Intronic
944326297 2:198408513-198408535 CCAAGTTATTGGTTGAAGCTGGG + Intronic
1168853851 20:995041-995063 CCCAGCTGTGAGTAGAAGTGAGG - Intronic
1169052159 20:2589219-2589241 CCAAGCTTTTAGTTGAGGCCTGG - Intronic
1169929019 20:10812081-10812103 TCAAGCTGTTGGCAGAAGCTGGG - Intergenic
1170083899 20:12508026-12508048 CCAATCTGTTAGTAGTTGATAGG + Intergenic
1172454522 20:35057742-35057764 CCAAGCTGGGACTAGAACCTGGG - Intronic
1173346571 20:42205846-42205868 GCCAGCTTTTAGTAGAAGCAGGG - Intronic
1173851071 20:46218717-46218739 CCAAGCTGTTATTGGAAGCAGGG + Intronic
1174934458 20:54852325-54852347 CCAAGCCATAATTAGAAGCTTGG - Intergenic
1175042718 20:56070662-56070684 GCAAGTTGTTAATAGAATCTAGG + Intergenic
1178025832 21:28465504-28465526 CCAGGATCTTAATAGAAGCTGGG - Intergenic
1178768195 21:35475119-35475141 CAAAGCTGTTTGAGGAAGCTGGG + Intronic
1182991332 22:34770729-34770751 CCAAGCAGATAGTAGACGCTAGG - Intergenic
1183317190 22:37143146-37143168 CCAAGCTTTTTGGATAAGCTCGG - Intronic
1184075932 22:42177949-42177971 CGAAGCTGTGATTAGCAGCTTGG + Intronic
949185912 3:1191309-1191331 CCAAGCTGTTAGTAGAAGCTTGG + Intronic
950708759 3:14800539-14800561 CCAGGCTGTGAGCAGGAGCTGGG + Intergenic
954155257 3:48681783-48681805 GCGAGCAGTGAGTAGAAGCTGGG + Intronic
956275975 3:67501636-67501658 CCAAACTATGATTAGAAGCTTGG + Intronic
960463544 3:117967192-117967214 CGAAGCTGGTAGAAGAAGGTGGG + Intergenic
961645360 3:128389904-128389926 CCATGTTGGTAGCAGAAGCTGGG + Intronic
962906358 3:139806697-139806719 CCAAACTTTTAGAAGCAGCTTGG - Intergenic
968812645 4:2806890-2806912 CCAAGCTGTTGGTGGATGCTTGG - Intronic
970801531 4:19978303-19978325 GTAAGCTGTTAGAAGCAGCTAGG - Intergenic
972353827 4:38261803-38261825 CCTAGCACATAGTAGAAGCTCGG + Intergenic
972610546 4:40651863-40651885 CCATGCTGTTAGTAGAAATGAGG + Intergenic
972702451 4:41507370-41507392 CCAAGCTACGATTAGAAGCTTGG - Intronic
975637320 4:76463361-76463383 CTAAGCTGTTAGAAGCAGCCAGG - Intronic
975713664 4:77185365-77185387 TCAAGCTGTTTTTTGAAGCTGGG - Intronic
977392544 4:96429808-96429830 CCAAACTTTAATTAGAAGCTTGG - Intergenic
979460372 4:120975726-120975748 CTAAGCAATTAGGAGAAGCTAGG - Intergenic
979610152 4:122681463-122681485 CTATGCTGTTAGCAGAAGCCAGG - Intergenic
979918300 4:126467840-126467862 CTAAGGTGTTAGTACATGCTAGG + Intergenic
983556895 4:169067247-169067269 GCAAGATGATAGTAAAAGCTTGG + Intergenic
989478895 5:41905031-41905053 CTAAGCTGTTAGGAAAAACTGGG + Intronic
992272209 5:75076680-75076702 CCAAGCCTTGATTAGAAGCTTGG - Intronic
995836795 5:116407418-116407440 CCTTGCTGGCAGTAGAAGCTGGG - Intronic
999224044 5:150005204-150005226 CCATACTGATGGTAGAAGCTAGG + Intronic
1003089156 6:3086863-3086885 CCAAGCTATAATTAGAAGGTTGG - Intronic
1003507718 6:6753281-6753303 CCAAGCTATGATTAGAAGCTTGG + Intergenic
1003946455 6:11080495-11080517 CCAAGCCATGATTAGAAGCTTGG - Intergenic
1007795567 6:44344014-44344036 CCCAGCTATTAATATAAGCTAGG + Intronic
1007963951 6:45986365-45986387 CCAAGCTGGGAGTAGAAGCTGGG - Intronic
1010248954 6:73688613-73688635 CCAAGCTATGATTAGAAGCCTGG + Intergenic
1012663934 6:101942725-101942747 GTATGCTGTTAGTAGAAGCCAGG - Intronic
1012676720 6:102123380-102123402 CCAAGTTTTCAGCAGAAGCTGGG + Intergenic
1012791695 6:103706822-103706844 ACAAAATGTTAGTAGATGCTGGG - Intergenic
1013059086 6:106614471-106614493 CCAAACTATAAGTAGAAGCTGGG + Intronic
1017430784 6:154368713-154368735 TCAAGATGTTACTAGCAGCTAGG + Intronic
1019042915 6:169121060-169121082 CCAAGCTCTTAGTTGTAGTTGGG + Intergenic
1019371677 7:665310-665332 CCCAGCTTGGAGTAGAAGCTGGG - Intronic
1019675252 7:2307737-2307759 CCATGCGGTGATTAGAAGCTTGG - Intronic
1022711352 7:32853937-32853959 CCAAGCTAGAATTAGAAGCTGGG - Intergenic
1024204139 7:47140752-47140774 ACTAGCTGCTAGTAAAAGCTAGG - Intergenic
1025261588 7:57423652-57423674 CCAAGCTGTTACTGGAGTCTTGG - Intergenic
1028235842 7:88360890-88360912 CCAAGCTATGATTAGAAGCTGGG + Intergenic
1028930548 7:96408591-96408613 TGAAGCTGTCAGTAGAAGCAGGG - Intergenic
1030778659 7:113569148-113569170 CCATGCTGTGAGTTGAGGCTGGG + Intergenic
1032858205 7:135854435-135854457 CCAAGCCATGACTAGAAGCTTGG - Intergenic
1034365257 7:150540668-150540690 GTAAGCTGTTAGAAGCAGCTGGG + Intergenic
1034709328 7:153176949-153176971 CACAGCTGCTAGTGGAAGCTAGG - Intergenic
1035788142 8:2278672-2278694 CCAAGCCGTGATTAGAAGTTTGG + Intergenic
1035804665 8:2443033-2443055 CCAAGCCGTGATTAGAAGTTTGG - Intergenic
1037029289 8:14083256-14083278 CCAAGCCATGACTAGAAGCTTGG + Intergenic
1039285754 8:36038989-36039011 CCAGGCTATTAGTAGAAGTCCGG + Intergenic
1041084728 8:54246103-54246125 CCAAGCTGTTACTGGGCGCTGGG + Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1043028851 8:75106098-75106120 CCAAGGCATTATTAGAAGCTTGG - Intergenic
1044702623 8:94978148-94978170 CCAAGCCATGATTAGAAGCTTGG + Intronic
1046754073 8:117955356-117955378 CTAAACTGTCATTAGAAGCTTGG - Intronic
1047162089 8:122392026-122392048 CCAAACCCTAAGTAGAAGCTTGG - Intergenic
1047572099 8:126110342-126110364 CCAAGCCATGATTAGAAGCTTGG + Intergenic
1049355206 8:142184238-142184260 CCAAGCTGTTTATAGATTCTGGG + Intergenic
1050419096 9:5444439-5444461 CCAAGCCATGATTAGAAGCTTGG + Intergenic
1052221972 9:26035419-26035441 TCAAGCTGTCACTAGAAGTTAGG - Intergenic
1052685162 9:31746123-31746145 CCAAGCCTTAATTAGAAGCTTGG + Intergenic
1053671831 9:40373629-40373651 CCAATCTGTTGGAAAAAGCTTGG - Intergenic
1053876422 9:42551188-42551210 CCCATCTGTTCGTGGAAGCTTGG + Intergenic
1053921643 9:42999991-43000013 CCAATCTGTTGGAAAAAGCTTGG - Intergenic
1054235276 9:62550533-62550555 CCCATCTGTTCGTGGAAGCTTGG - Intergenic
1054382945 9:64513677-64513699 CCAATCTGTTGGAAAAAGCTTGG - Intergenic
1054512789 9:66002681-66002703 CCAATCTGTTGGAAAAAGCTTGG + Intergenic
1056624524 9:88243828-88243850 CCAAGCCATCATTAGAAGCTTGG + Intergenic
1057292972 9:93818930-93818952 CCAGGCTGTGAGCAGAAGATGGG - Intergenic
1188350066 X:29118655-29118677 CTAAGTTGTTAGAACAAGCTAGG + Intronic
1190142493 X:47860476-47860498 CCAAGCTGTGATTAGAAGCTTGG + Intronic
1191730564 X:64330631-64330653 CCAAGCTGTTAGTTTAAGTGAGG + Intronic
1192174742 X:68878594-68878616 TCAAGCTGTTATTTGGAGCTTGG + Intergenic
1192773354 X:74216524-74216546 CCAGGATTATAGTAGAAGCTAGG - Intergenic
1192810703 X:74544761-74544783 CCAAGCTGTGATAAAAAGCTTGG + Intergenic
1192965740 X:76174631-76174653 CCCAGCTGCTAGTGAAAGCTGGG - Intronic
1196364967 X:114913691-114913713 CCAAGCCATGATTAGAAGCTTGG - Intergenic
1199742234 X:150746237-150746259 CCAATCAGTTTGTTGAAGCTGGG - Intronic
1201758418 Y:17514506-17514528 CACAGCTGTGGGTAGAAGCTGGG - Intergenic
1201843137 Y:18391484-18391506 CACAGCTGTGGGTAGAAGCTGGG + Intergenic