ID: 949187190

View in Genome Browser
Species Human (GRCh38)
Location 3:1206334-1206356
Sequence GAAAATACACTGATGCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949187190_949187196 23 Left 949187190 3:1206334-1206356 CCCACATGCATCAGTGTATTTTC 0: 1
1: 0
2: 0
3: 20
4: 222
Right 949187196 3:1206380-1206402 TTCCCTCCTGTTACTGTGGATGG 0: 1
1: 0
2: 4
3: 29
4: 248
949187190_949187194 19 Left 949187190 3:1206334-1206356 CCCACATGCATCAGTGTATTTTC 0: 1
1: 0
2: 0
3: 20
4: 222
Right 949187194 3:1206376-1206398 TGCCTTCCCTCCTGTTACTGTGG 0: 1
1: 2
2: 15
3: 49
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949187190 Original CRISPR GAAAATACACTGATGCATGT GGG (reversed) Intronic
901560316 1:10065102-10065124 AAAAATAAACTGATGAATCTAGG - Intronic
902137508 1:14322822-14322844 GAAAACAAACTAATACATGTGGG - Intergenic
903749417 1:25611479-25611501 GAAGAGACACTGATGACTGTGGG - Intergenic
904712143 1:32438247-32438269 GAGGATATACTGAAGCATGTTGG - Intergenic
907838959 1:58138051-58138073 AAAAATATAATGATGAATGTTGG + Intronic
910526243 1:88182104-88182126 TAAAGTACACTGGTGCATATCGG - Intergenic
911622306 1:100079079-100079101 AAAAATTTACTGATGAATGTTGG + Intronic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
914848870 1:151299263-151299285 GAAACTACACTCAGGTATGTGGG + Intronic
915874771 1:159600881-159600903 GAAAGTACAATGATGGAAGTTGG + Intergenic
916383851 1:164244957-164244979 GAAAGAATACTGATGCATGCAGG + Intergenic
916741809 1:167652433-167652455 GAAAATACACTCAAGTATCTGGG - Intronic
917212901 1:172647841-172647863 AAAAAAACAGTGATCCATGTTGG - Intergenic
917864914 1:179185129-179185151 GAAAGTAGACAGATGCATATTGG - Intronic
921563632 1:216688955-216688977 TAAAATACAGAGATGCATATGGG + Intronic
922569824 1:226627812-226627834 GAAAATGGACTAATGCAGGTGGG - Intergenic
924195087 1:241598231-241598253 AAAAAAACACTGAAGGATGTAGG - Intronic
1063787730 10:9404136-9404158 TAAATTACACTTATGCATGCTGG - Intergenic
1064355892 10:14617672-14617694 GAAAGGACACTGCTGCATCTAGG + Intronic
1064782963 10:18863091-18863113 GAACATGCTATGATGCATGTGGG + Intergenic
1065995241 10:31053473-31053495 GACTATACATTCATGCATGTTGG - Intergenic
1066328447 10:34391228-34391250 GAAAGTAGACAGATACATGTTGG + Intronic
1067969814 10:50956948-50956970 GGAAATGCACTGATGTATTTAGG + Intergenic
1069285110 10:66704447-66704469 AAAAACACAGTAATGCATGTAGG + Intronic
1069760826 10:70809833-70809855 GAAAACACAGTGAAGCTTGTGGG - Intergenic
1070078098 10:73157786-73157808 GAAACAGCAGTGATGCATGTAGG - Intronic
1075514475 10:123098128-123098150 GAAGATACACAGATACATGGAGG + Intergenic
1075882322 10:125864180-125864202 GAAGATACTCTGATGCATTGTGG - Intronic
1077527053 11:3073297-3073319 GAAAATTCAGTGATGCAGGAGGG + Intergenic
1079176529 11:18147001-18147023 GAAAAAAAGCTAATGCATGTTGG - Intronic
1079911581 11:26316907-26316929 GTAAATACAAAGTTGCATGTAGG - Intronic
1079927759 11:26516593-26516615 GAAAATGCACTAATGCACATAGG + Intronic
1085650314 11:78261930-78261952 CAAAATACAGTGATGTATTTTGG - Intronic
1085788049 11:79472235-79472257 GTAAATACACTCATGCAAGGAGG - Intergenic
1087579278 11:100031252-100031274 GTAAATACAAAGTTGCATGTGGG + Intronic
1088093479 11:106071670-106071692 CAAAATACACTTATACAAGTAGG - Intronic
1090429434 11:126633778-126633800 AAACATACACTGATGGATGATGG - Intronic
1090540143 11:127692926-127692948 GAGAAGACACTGATGCAATTCGG - Intergenic
1092028925 12:5267629-5267651 GAAAAATAACTGATGCATGCGGG + Intergenic
1093054381 12:14540547-14540569 GAAAATACACAGAAACAAGTTGG + Intronic
1093601283 12:21027236-21027258 GAAAAATAGCTGATGCATGTTGG + Intronic
1094449626 12:30571291-30571313 GAAAAAACATTGGTGCATTTTGG + Intergenic
1094505004 12:31054237-31054259 GAAAATACATTTATGTCTGTTGG + Intergenic
1096258915 12:50078891-50078913 GAAAAGACAATGATGCAGGATGG - Intronic
1098113081 12:67144805-67144827 AAAAACACACTGAAGCATGAAGG + Intergenic
1099156589 12:79184055-79184077 GGAAAAATACTGATCCATGTGGG - Intronic
1100328292 12:93562231-93562253 GAAAAATGACTAATGCATGTGGG + Intergenic
1100342404 12:93691917-93691939 GAAAAATAACTAATGCATGTGGG + Intronic
1100845095 12:98650102-98650124 GAGAACACACTGATGAATGGGGG - Intronic
1104246995 12:127053104-127053126 GAAATTACACAGAGGCCTGTAGG + Intergenic
1105847366 13:24304923-24304945 CAAAATACAATGATATATGTTGG + Exonic
1106577560 13:30989809-30989831 GATAATACACGGATGCAGGGAGG - Intergenic
1107610556 13:42108382-42108404 GAAAATACACTGCTGCTAGCAGG + Intronic
1109135911 13:58650378-58650400 GCACATAATCTGATGCATGTGGG + Intergenic
1109327003 13:60879768-60879790 GAACATCCACTGATACATTTAGG - Intergenic
1110193732 13:72761654-72761676 GAAAAGCCACTGATGCACGTTGG + Exonic
1110381750 13:74859467-74859489 GACAAATCACTAATGCATGTGGG + Intergenic
1110569173 13:76986182-76986204 GAAACTACACTGATTCTTCTGGG - Intergenic
1111236780 13:85419360-85419382 GAAAATAGATTGATACATTTTGG - Intergenic
1111628565 13:90820122-90820144 GAAAATACATTAATGCTTGAGGG + Intergenic
1114037075 14:18639338-18639360 GGAAAGACACTGATGAAAGTGGG + Intergenic
1114121565 14:19675706-19675728 GGAAAGACACTGATGAAAGTGGG - Intergenic
1115718365 14:36130977-36130999 AAAAATACACTGTTGTTTGTTGG + Intergenic
1116098751 14:40407316-40407338 GAAAACAGACTAATACATGTGGG - Intergenic
1116272400 14:42788415-42788437 CAAAATAAACTGCTACATGTAGG - Intergenic
1117007652 14:51438027-51438049 GAAAGTAGACAGATGCATGTTGG - Intergenic
1117369612 14:55064417-55064439 GAAATTACACTAATGCAAGGAGG - Intronic
1118809693 14:69263930-69263952 GAATCTACACTGATGCACGCTGG + Intronic
1120380353 14:83770253-83770275 GAAAAAGCAATGATGCATGCAGG - Intergenic
1121232765 14:92369928-92369950 GAAAAGATACTGATGGATTTAGG + Intronic
1124336046 15:28857909-28857931 GAAAAGAGACTGGTGCAGGTGGG + Intergenic
1125468460 15:39977943-39977965 GAGTATACATTGATGCCTGTGGG + Intronic
1126651996 15:50932357-50932379 GAAAATAAATTGATGAATCTAGG - Intronic
1127704420 15:61532968-61532990 GTAAAAACACTGAGGGATGTAGG - Intergenic
1127913743 15:63438811-63438833 GAGAACACACGGATGCATGGTGG + Intergenic
1128200799 15:65805421-65805443 AAAAATAACCTTATGCATGTAGG - Intronic
1130171834 15:81523043-81523065 TAAAATACACTGATTGGTGTAGG - Intergenic
1135820988 16:25685665-25685687 GAAAATACAGTTAGGCATGGTGG - Intergenic
1137417952 16:48302661-48302683 GAAAATACACTGAAGAAAGGTGG + Intronic
1138751740 16:59430695-59430717 GAAAAATAACTAATGCATGTTGG + Intergenic
1139089253 16:63624215-63624237 GAAAATGAGCTAATGCATGTTGG - Intergenic
1140256883 16:73345351-73345373 GAAAAATAACTGATGCATGCTGG - Intergenic
1142934133 17:3312944-3312966 CAAAATACACTGATTTATGTTGG + Intergenic
1144293218 17:13846502-13846524 TAAAATACACTGATGAATAGTGG - Intergenic
1144802243 17:17937676-17937698 GAAAAGAGACTGTAGCATGTGGG - Intronic
1146785915 17:35721242-35721264 GAACATACACTGCTTCACGTGGG - Intronic
1146933404 17:36793921-36793943 GAAACTTCAATGATGCATGTAGG + Intergenic
1149677104 17:58475692-58475714 GAAAGTAGACAGATACATGTTGG + Intronic
1154130411 18:11731869-11731891 GAAAATAGACTAATGGTTGTTGG - Intronic
1155608912 18:27640741-27640763 GAGAATACATGGATGCATGATGG + Intergenic
1156908614 18:42384197-42384219 GAAAATACACTGAAGTATTTAGG - Intergenic
1157434500 18:47657003-47657025 GAAAATACAGAGAAGCATGCAGG + Intergenic
1159031229 18:63234280-63234302 GAAAACACATTGATGCAGGGAGG - Intronic
1159734124 18:72073313-72073335 GAAAATGGAGTGATGCATTTTGG + Intergenic
1160119410 18:76114570-76114592 AAATATACACTGATGTATTTAGG - Intergenic
1167202254 19:48074096-48074118 GAAAATTAGCTAATGCATGTGGG - Intronic
1168360611 19:55736899-55736921 TAAAATACCCTCAAGCATGTGGG + Intronic
1168444894 19:56403658-56403680 TAAAGGACACTGATGCATATTGG - Intronic
1168724583 19:58573695-58573717 GAAAATGCAATGGGGCATGTGGG + Intergenic
925876566 2:8316348-8316370 GAAAATGGACTAATGCATGAAGG - Intergenic
926160533 2:10486002-10486024 GAAAAATCACACATGCATGTGGG - Intergenic
927316008 2:21683911-21683933 GAAAATAGAATGATGGTTGTAGG + Intergenic
927320217 2:21735072-21735094 GAAACATAACTGATGCATGTTGG + Intergenic
929737731 2:44568255-44568277 GCAAATGCACTGATGAAAGTAGG - Intronic
930458063 2:51631995-51632017 GAAAATGTACTGAAGCATGTTGG + Intergenic
934952536 2:98587492-98587514 GAAAATACAATGAAGAATGTTGG + Exonic
938441655 2:131340168-131340190 GGAAAGACACTGATGAAAGTGGG + Intronic
938506523 2:131889918-131889940 GAAAAATAACTAATGCATGTTGG + Intergenic
939660291 2:144880879-144880901 GAGATTACACTGGTGGATGTAGG - Intergenic
940872895 2:158874442-158874464 GAAAACCCACTGAAGAATGTTGG - Intergenic
942725177 2:178998472-178998494 GAAAAAAAACTGAAGCATGGAGG - Intronic
943728589 2:191277957-191277979 GATAATACAGTGATACAAGTAGG + Intronic
943739453 2:191395551-191395573 GAATATACACTGAAACATGGGGG - Intronic
948968174 2:241400976-241400998 GAACTTACTCTGATGCCTGTGGG - Intronic
1173088317 20:39946185-39946207 GTACATACACTTATGCATGCAGG - Intergenic
1173393501 20:42656238-42656260 GAAAATAGAGGGATGGATGTGGG + Intronic
1174990590 20:55505027-55505049 GCAAAAACAGAGATGCATGTGGG - Intergenic
1175071954 20:56342291-56342313 ATAAATACACTGATGCACTTTGG + Intergenic
1177985716 21:27972459-27972481 GAAAAATAACTAATGCATGTTGG - Intergenic
1180461199 22:15566386-15566408 GGAAAGACACTGATGAAAGTGGG + Intergenic
1181046123 22:20215135-20215157 GAGAGTAAACTGAGGCATGTGGG + Intergenic
1182905101 22:33929166-33929188 CTTAATACAATGATGCATGTGGG - Intergenic
1183268833 22:36848121-36848143 GAAAATACCTTGATTCATTTTGG + Intergenic
949187190 3:1206334-1206356 GAAAATACACTGATGCATGTGGG - Intronic
951898180 3:27631431-27631453 GAAAATAGAGGGATCCATGTAGG + Intergenic
951978378 3:28539913-28539935 GAAAAGACCCTGATGAATCTGGG + Intergenic
952603869 3:35120074-35120096 CAAAATACAGTGATGTAAGTAGG - Intergenic
953347364 3:42187455-42187477 GAAAAAAGAATGATGCTTGTGGG - Intronic
954900842 3:54018318-54018340 GAGAATGCATGGATGCATGTTGG + Intergenic
957544022 3:81613510-81613532 GAAAATAGACAGATACATGTTGG - Intronic
958593288 3:96188452-96188474 GAAAATTCACTTCTGCATGAAGG + Intergenic
959971169 3:112411522-112411544 GCAAAGAGACTGAAGCATGTGGG - Intergenic
960116197 3:113895302-113895324 GGAAATACACTAATGCACGGTGG - Intronic
961348809 3:126285795-126285817 GAAAGTATAGTGATGCCTGTTGG + Intergenic
962888290 3:139648376-139648398 GAAAATGGACTGATATATGTAGG + Intronic
963173814 3:142278235-142278257 GAAAAGACATTGATCCATTTTGG + Intergenic
963532561 3:146489144-146489166 CAACATACACTGGGGCATGTTGG + Intronic
963957459 3:151270593-151270615 GAAAGTAGACAGATACATGTTGG - Intronic
964704579 3:159604215-159604237 GAAAAGACAAAGATGGATGTTGG - Intronic
964769823 3:160212539-160212561 GAAAAGACACTGAGGACTGTGGG - Intergenic
965381609 3:167996288-167996310 GAAGACACATTGAGGCATGTGGG + Intergenic
966263519 3:178009169-178009191 CAACATACACTGAGGCCTGTCGG + Intergenic
966573243 3:181471045-181471067 CAAAGTACACTGAGGCATGTCGG - Intergenic
966656777 3:182367349-182367371 GGAAATAAACTGCTGCATTTTGG - Intergenic
969034102 4:4237969-4237991 TAAAATATATTGATGCATATTGG - Intronic
970053565 4:11945441-11945463 GAAAAAATAGTGATGCATATTGG - Intergenic
971162359 4:24146585-24146607 GAAAAAACGCTGATGCAGATTGG - Intergenic
972210267 4:36828131-36828153 GAAAATACACTTAAGCAAGGAGG + Intergenic
973804419 4:54512019-54512041 ATAAATACACGAATGCATGTAGG - Intergenic
976814567 4:89132643-89132665 TAAAATACAATGATGGAAGTAGG - Intergenic
977307318 4:95341741-95341763 AAAAATGCACTGAAGAATGTAGG + Intronic
977387836 4:96366678-96366700 GAAAATAAACTTTTTCATGTTGG + Intergenic
977866847 4:102038988-102039010 GAAAACACACTGCTGCATGAAGG - Intronic
979450410 4:120864069-120864091 AATAATACACTGCTGCATGGAGG + Intronic
981724527 4:147833514-147833536 GAAAACAGACTAATTCATGTGGG + Intronic
982267730 4:153554966-153554988 GCAAATACACTAATTCATGAAGG - Intronic
982601002 4:157448687-157448709 GAAAATACTCTCATGCTTCTAGG + Intergenic
982938249 4:161513810-161513832 GAGAACACACTGAGGCCTGTTGG + Intronic
988648253 5:33120144-33120166 GAAAACACACTGAAGGATTTAGG + Intergenic
990873494 5:60459412-60459434 GAAAATAGACAGATACATGTTGG + Intronic
991195297 5:63924979-63925001 GAAAATGGACTAATACATGTGGG + Intergenic
991553589 5:67870474-67870496 GAAAACACATTCATGGATGTGGG - Intergenic
993362332 5:86993182-86993204 GGAAATACAATTATGGATGTAGG - Intergenic
993661952 5:90648457-90648479 GAAAATACACTAATGTATTTAGG - Intronic
996253012 5:121360882-121360904 GAAAATACACTAAAGCAGGTTGG - Intergenic
999936436 5:156491521-156491543 GCAAATACGCTGATCCATTTTGG - Intronic
1000608253 5:163347577-163347599 TAAAAAACTCTCATGCATGTTGG + Intergenic
1000803679 5:165760747-165760769 GAAAATACGCTAATGGATATTGG + Intergenic
1001145793 5:169183306-169183328 GAGAGTACACTGATGTATGAAGG + Intronic
1003416088 6:5909650-5909672 GAAAACAAACTGATCCCTGTGGG - Intergenic
1003697386 6:8423839-8423861 GCATTTACACTGATGCATATGGG - Intronic
1004384262 6:15158873-15158895 GAGAATGCTCTGTTGCATGTGGG + Intergenic
1004586290 6:17004447-17004469 GAAAATACACTGTTACAAGTTGG + Intergenic
1006986035 6:38176307-38176329 GAAAAAACAGTGATGCAGGGAGG - Intronic
1008214731 6:48774225-48774247 GAAAATACACTTACACATTTAGG + Intergenic
1008766095 6:54916751-54916773 GATAGTACACAGATGAATGTGGG + Intronic
1010672560 6:78703496-78703518 GAATATACACTGATGATTGTAGG + Intergenic
1010718682 6:79258964-79258986 GACAAACCACTAATGCATGTGGG - Intergenic
1010740569 6:79498110-79498132 AAATACACACTGATGCATTTAGG + Intronic
1014307668 6:119762507-119762529 GTGAATACACTGATTCATCTGGG - Intergenic
1015322268 6:131889397-131889419 GAAAATACACTGGGGCCTGTTGG - Intronic
1016226260 6:141742291-141742313 GAGAACACACGGATACATGTGGG + Intergenic
1016874698 6:148853075-148853097 GAAAAATAGCTGATGCATGTGGG - Intronic
1017217062 6:151921046-151921068 GAAAAACAACTAATGCATGTTGG - Intronic
1017996906 6:159540275-159540297 GAAAATTCACTGCCGGATGTAGG + Intergenic
1018020248 6:159756147-159756169 GAAAATGCACAGATGTATGGTGG - Exonic
1019022304 6:168929576-168929598 GAAAACACACTAATACAGGTAGG + Intergenic
1020527975 7:9288346-9288368 AAAAATAAACTGATGAATATTGG - Intergenic
1020771087 7:12396227-12396249 GAAAATAATCTAATGCAGGTTGG - Intronic
1023221742 7:37926320-37926342 GGAAATACACTGAAGCATTTGGG - Intronic
1023294133 7:38697646-38697668 TAAAATACACAGATGAATGTGGG + Intergenic
1023492247 7:40755995-40756017 CAAACTACACTAATGCATGGTGG - Intronic
1023925832 7:44669024-44669046 GAAAATACACTGAAGGAACTGGG - Intronic
1024806080 7:53141660-53141682 GAAAACACACAGCTGTATGTTGG - Intergenic
1026658924 7:72281697-72281719 GAAACTAGAGTGATGCATGGTGG - Intronic
1027337487 7:77168877-77168899 GGAAATATAGTGATGCATTTAGG - Intronic
1028027180 7:85858944-85858966 ATAAATACACTGTTGCATGATGG - Intergenic
1028745928 7:94326845-94326867 GAAAAGACAGTGAACCATGTGGG + Intergenic
1029778256 7:102701924-102701946 GGAAATATAGTGATGCATTTAGG + Intergenic
1030007716 7:105135013-105135035 GAATATACACTGATTCACCTGGG + Intronic
1030803630 7:113886547-113886569 GAAAATAGACTAATACAGGTGGG + Intronic
1031789425 7:126082252-126082274 AAAAATGCACTGATCCATTTAGG + Intergenic
1032206704 7:129872175-129872197 GAAAATACAGTGGTACAAGTAGG + Intronic
1033116927 7:138633726-138633748 CAAAATACAATGATGAATATGGG + Intronic
1034755855 7:153618696-153618718 GAAAAATCACTAATGCATGCTGG - Intergenic
1035308423 7:157949217-157949239 GAAAGTAAAATGATGCATTTTGG + Intronic
1039072530 8:33659850-33659872 GAAAATGAACTAATACATGTGGG + Intergenic
1039188248 8:34941821-34941843 AAAAATAAACTGATGCAAGAAGG - Intergenic
1043043422 8:75291032-75291054 GAAAATACAAAGAGGCATCTTGG - Intergenic
1043097275 8:75991273-75991295 AAAAGCACACTGATGCATCTGGG - Intergenic
1044942452 8:97357102-97357124 GAAAACAGACTAATACATGTAGG - Intergenic
1045334337 8:101185256-101185278 GAAAATACATTGCTGCATCGGGG - Intronic
1048698412 8:137055642-137055664 GAAAATGCACTGATGCCCATGGG + Intergenic
1048998956 8:139812695-139812717 GAAAATACACTAATTTATATAGG - Intronic
1049453592 8:142675815-142675837 GAAAACCCACTGATGCACATGGG - Intronic
1050579647 9:7039093-7039115 GAAAATATACTGATGAAGTTAGG - Intronic
1052071323 9:24084947-24084969 GAAAATACACTGTTATAAGTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058082067 9:100711390-100711412 GAAAATGGACTGATGCAAGGAGG - Intergenic
1058938597 9:109792090-109792112 GTAGATACACTTATGTATGTTGG + Intronic
1059104253 9:111498102-111498124 GAAAATACAGTAAAGCATGGTGG + Intergenic
1061128841 9:128695112-128695134 GAAAGTAGACAGATACATGTTGG - Exonic
1062064127 9:134517254-134517276 GAAAATAGACTGATGGCTGCTGG - Intergenic
1062741817 9:138179409-138179431 GAACATACTCTGCTGCCTGTAGG - Intergenic
1187074329 X:15918888-15918910 GAAAGTAGACGGATGCATGTTGG - Intergenic
1187289522 X:17939794-17939816 GGAAATACACTGAAGAATTTGGG + Intergenic
1188347841 X:29089172-29089194 GAAAAAACACTGCTGGATTTAGG + Intronic
1189586862 X:42470682-42470704 GAAAGTAAACTGATGCAGTTCGG + Intergenic
1189597114 X:42580183-42580205 GGAAATACAATGTTGCATGTAGG + Intergenic
1190545422 X:51521093-51521115 GAAATAACACTGAAGCATTTAGG - Intergenic
1192349253 X:70342627-70342649 GAGAGCACACTGATGCATGAAGG - Intronic
1192789974 X:74371942-74371964 GGAAATAGACTGAAGCAGGTAGG - Intergenic
1193266466 X:79476946-79476968 CAACACACACTGATGCCTGTTGG - Intergenic
1193727320 X:85058186-85058208 GAAAAATAGCTGATGCATGTTGG - Intronic
1194989519 X:100531349-100531371 CAAAATACACTGGGGCCTGTTGG - Intergenic
1196407841 X:115384019-115384041 CAATATACACTGAAGCCTGTCGG - Intergenic
1198477699 X:137011342-137011364 GAAAATTAGCTGAGGCATGTTGG - Intergenic
1199588815 X:149446303-149446325 GCATACACACTGATGCCTGTTGG - Intergenic
1200761559 Y:7043662-7043684 TAAAATACACAGACCCATGTGGG - Intronic