ID: 949188261

View in Genome Browser
Species Human (GRCh38)
Location 3:1219647-1219669
Sequence GATCTAAGGTGTTAAAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949188256_949188261 14 Left 949188256 3:1219610-1219632 CCAAATGAGGTGAAACTTTACCA 0: 1
1: 0
2: 2
3: 16
4: 139
Right 949188261 3:1219647-1219669 GATCTAAGGTGTTAAAGTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 112
949188257_949188261 -6 Left 949188257 3:1219630-1219652 CCACATAACTGCCTTGTGATCTA 0: 1
1: 0
2: 1
3: 18
4: 184
Right 949188261 3:1219647-1219669 GATCTAAGGTGTTAAAGTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 112
949188255_949188261 15 Left 949188255 3:1219609-1219631 CCCAAATGAGGTGAAACTTTACC 0: 1
1: 0
2: 0
3: 16
4: 209
Right 949188261 3:1219647-1219669 GATCTAAGGTGTTAAAGTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949188261 Original CRISPR GATCTAAGGTGTTAAAGTCA GGG Intronic
904836509 1:33340991-33341013 CATTTAAGATGTTAAACTCAGGG - Intronic
909156382 1:72083072-72083094 GATCCAAGATTTTAAAATCATGG - Intronic
911644210 1:100321100-100321122 GATGGGAGGTGTTTAAGTCATGG + Intergenic
912025002 1:105159174-105159196 GATGGAAGATGTTTAAGTCATGG - Intergenic
918211639 1:182356774-182356796 GATCTACGGTGGCAGAGTCAGGG + Intergenic
919063336 1:192662525-192662547 GATCTAAGGAGGCAAACTCATGG + Intergenic
919328993 1:196145210-196145232 CTTCTAAGGTGACAAAGTCATGG - Intergenic
922340254 1:224649141-224649163 CATATAAGGTGATTAAGTCAAGG + Intronic
1064940352 10:20727479-20727501 GACCTAAGGTGTGAAAGAAATGG - Intergenic
1071396158 10:85226073-85226095 GATGGAAGGTGTTTGAGTCATGG - Intergenic
1079982566 11:27166575-27166597 AGTCTAAGGTGTTAACATCAGGG - Intergenic
1085437172 11:76517142-76517164 GTTCTAACATTTTAAAGTCAAGG + Intronic
1091419415 12:323151-323173 GCTATATGGTGTAAAAGTCAGGG - Exonic
1095267541 12:40177606-40177628 GACTTAAGGACTTAAAGTCATGG - Intergenic
1095398086 12:41783766-41783788 TATCCAAGGTTTGAAAGTCAAGG + Intergenic
1096447905 12:51710932-51710954 TAAATAAAGTGTTAAAGTCAAGG + Intronic
1098379986 12:69858604-69858626 TATCTAAGTTGTTAAATTTATGG + Intronic
1098772758 12:74575330-74575352 GATCTAATGGTTTAAAATCATGG + Intergenic
1102834966 12:116047680-116047702 GATCTAAGGTGTTTAACTAACGG + Intronic
1106217323 13:27714904-27714926 AATCTAAGTTGATAAAGACAAGG + Intergenic
1106393125 13:29354995-29355017 TATCTATGGTGTGAAGGTCATGG + Intronic
1106785390 13:33102935-33102957 GATCTAAGGGATTAAAGTGATGG - Intergenic
1107406245 13:40116553-40116575 GAGTTATGGTGATAAAGTCAGGG - Intergenic
1110823067 13:79938625-79938647 ATTGTAAGGTGTGAAAGTCACGG - Intergenic
1112807713 13:103181301-103181323 AATCTAAGGTGCTAAAGGGATGG - Intergenic
1115067115 14:29277206-29277228 TATCGAAGGTGTTCATGTCATGG - Intergenic
1116086402 14:40244288-40244310 GATCTACGGGGTAAAAGCCAGGG - Intergenic
1123744681 15:23310538-23310560 GATCTAGGGTCTTAAATTCATGG - Intergenic
1126532310 15:49724831-49724853 GAGATAGGGTGGTAAAGTCAGGG - Intergenic
1127042101 15:54988499-54988521 GAATTAAGGTGGAAAAGTCAGGG - Intergenic
1128430994 15:67593320-67593342 GAGCTAAGGTGAGAAAGTAATGG - Intronic
1132249088 15:100319951-100319973 GATCTAAAGTGATAAAGGAAAGG + Intronic
1132257972 15:100394190-100394212 AATCTATGGTGCTAAAGTCAGGG - Intergenic
1133192019 16:4140947-4140969 GATGAAAGATGTTAAAATCATGG + Intergenic
1139327919 16:66166389-66166411 AGTCTAAGGTGTTAAACTCGAGG + Intergenic
1142574625 17:898349-898371 GATCAAAGGTGTTCCAGGCAGGG - Intronic
1146661523 17:34668049-34668071 AACCTAAGCTCTTAAAGTCAAGG - Intergenic
1153423927 18:4941958-4941980 GGTCTAAGGTGTTAAAGTGTGGG - Intergenic
1153496929 18:5709119-5709141 GATCCTAGGTATTAAAGTCTTGG - Intergenic
1163286821 19:16353887-16353909 GATGTAAGGTCTGAATGTCATGG + Intergenic
1164613979 19:29654726-29654748 CATCTAAGTTGTCAAATTCATGG + Intergenic
925783973 2:7410445-7410467 GCTTTAAAGTGTTAGAGTCATGG + Intergenic
926705356 2:15833717-15833739 GTTTTAAGCTGTTAAATTCAGGG + Intergenic
926981447 2:18575598-18575620 GAACTGAAGTGTTAAAATCAAGG - Intronic
927112319 2:19872373-19872395 GATCTAAGGAGTTGAATGCAAGG - Intergenic
929393582 2:41497764-41497786 GATATAAGGTTTCAAAATCAAGG + Intergenic
929918915 2:46158402-46158424 CATCCAAGGTGTTAAAGTGGGGG + Intronic
935387520 2:102515752-102515774 GATCAAAGGTGTCAAATGCAAGG - Intronic
935464744 2:103382966-103382988 GTTCTAAGGTGTCAAATACATGG - Intergenic
936498742 2:113048828-113048850 TATCTAAGATGTTAAATTTATGG - Intronic
939688592 2:145229501-145229523 GATCAAAATTGTGAAAGTCAGGG - Intergenic
939724698 2:145702898-145702920 TATCTAAGTTGTTGAATTCATGG + Intergenic
942516787 2:176762428-176762450 GATCTAAAGGGTTAAACTAAGGG - Intergenic
945283544 2:208060163-208060185 GATGGGAGGTGTTAAGGTCATGG - Intergenic
946337371 2:219047159-219047181 GATGTAAGATGTTAATGTAAGGG - Intergenic
946599883 2:221348174-221348196 GATCTAAGGAGCAAAAATCAGGG + Intergenic
946951120 2:224876535-224876557 AATATAAGGTGAGAAAGTCAAGG - Intronic
947382257 2:229556038-229556060 GATCTAAAATGTTATAGACAAGG + Intronic
1184501418 22:44876862-44876884 GATATAAGGTGTATCAGTCAGGG + Intergenic
949188261 3:1219647-1219669 GATCTAAGGTGTTAAAGTCAGGG + Intronic
949725668 3:7041701-7041723 GATTTTAGGTGTTAAATTCCAGG - Intronic
955579580 3:60404732-60404754 AATGTAAGTTTTTAAAGTCAGGG + Intronic
955781813 3:62492786-62492808 GCTCTAAGGTATTAAAATCTGGG + Intronic
956910983 3:73816742-73816764 ACTTTAAGGTGTAAAAGTCAAGG + Intergenic
958779469 3:98523238-98523260 GATCTAAGTTATACAAGTCACGG - Intronic
959756073 3:109900811-109900833 GTTCTAAGGTGGTAAAAACAAGG - Intergenic
960369450 3:116815863-116815885 GACCTTGGGTGTTATAGTCAGGG - Intronic
967272099 3:187740506-187740528 GACCTAAGAGGTTAAACTCATGG + Intronic
970383117 4:15528173-15528195 GCAGTAAGGTTTTAAAGTCAGGG - Intronic
970847012 4:20552467-20552489 GATCTAGGGGGTAAAAGACAAGG - Intronic
971299467 4:25429798-25429820 GCTCTCAGTTGTTAAAGTCATGG + Intergenic
975015502 4:69412389-69412411 GATCTAAAATGTTAAATTCTGGG - Intronic
975432365 4:74309120-74309142 GATTGGAGGTGTTACAGTCACGG - Exonic
976577576 4:86692386-86692408 CATCTAAGGTGGTATATTCAAGG - Intronic
976870803 4:89791163-89791185 GATCTAATGGTTTAAAATCATGG - Intronic
977279357 4:95020221-95020243 GATCTAATGAGTAGAAGTCAAGG + Intronic
981797908 4:148619000-148619022 GATGGAAGGTGTTTGAGTCATGG + Intergenic
982137541 4:152286183-152286205 AATCAAAGGTGTAACAGTCAAGG + Intergenic
982359372 4:154503081-154503103 GATCTTATGTGTTTAAATCATGG - Intergenic
988597161 5:32605845-32605867 CATCAAAGTTGTAAAAGTCAAGG - Intergenic
989731929 5:44659335-44659357 CATCTTTGGTGTTAAACTCATGG + Intergenic
992422449 5:76620065-76620087 GATCAGAGGTCTTAAAATCAAGG - Intronic
993134771 5:83945726-83945748 GATTTAATATGTGAAAGTCATGG + Intronic
996921388 5:128771679-128771701 GATTTATGGTGTTAAATCCAGGG - Intronic
1003335374 6:5166843-5166865 GATATAAGTTGTTATATTCAAGG + Intronic
1003842710 6:10138747-10138769 TCTATAAGGTGTTGAAGTCAAGG - Intronic
1004450403 6:15739910-15739932 GATCAAAGGTAGTAAAGTGAGGG - Intergenic
1004495668 6:16160499-16160521 AATCTAAGGTGTGAAGGTCTGGG + Intergenic
1009299398 6:61995622-61995644 GATCTCATGTGCAAAAGTCAGGG + Intronic
1011408987 6:87046115-87046137 GATCCTAGGAATTAAAGTCAAGG - Intergenic
1011767528 6:90639118-90639140 GATCTATGGTGTCAATCTCAGGG + Intergenic
1013428068 6:110033061-110033083 GATCAATGGTGGTATAGTCAAGG - Intergenic
1014187678 6:118454336-118454358 GATGACAGGTGTCAAAGTCAGGG + Intergenic
1014192116 6:118508116-118508138 CATCTAATGTGTTAAATTCTGGG - Intronic
1020794891 7:12667320-12667342 ACTCTAAAGGGTTAAAGTCAAGG - Intergenic
1022553038 7:31259967-31259989 GCTCTAAGGTGTGAAATTAAAGG + Intergenic
1024449800 7:49526188-49526210 GATATAAGTAGTTAAAGGCAAGG - Intergenic
1028313442 7:89368749-89368771 GATCTCATGAGTTAAAGTAATGG - Intergenic
1029215533 7:98946345-98946367 GCTGTAAGGTTTTAAATTCAGGG - Intronic
1031582676 7:123496206-123496228 GAAATAAGGTATAAAAGTCAAGG + Intronic
1032280377 7:130495092-130495114 GGGCTAAGGGGTTAAAGTCGGGG + Intronic
1036410394 8:8494486-8494508 CATTTAATGTGTTAAAGTCATGG - Intergenic
1040552605 8:48450239-48450261 ATTCTCAGGTGTTTAAGTCAGGG + Intergenic
1042288615 8:67142964-67142986 TATCTAAGACGTTAACGTCAGGG - Intronic
1045323765 8:101101588-101101610 GAGCTGAGGTCCTAAAGTCAAGG + Intergenic
1047673204 8:127171447-127171469 GATGTAAGCTGTAGAAGTCAGGG + Intergenic
1048173122 8:132127366-132127388 GTTCTAAGTTCCTAAAGTCAGGG + Exonic
1048893438 8:138967743-138967765 GAGCAAAGGTTTTAAAGACAGGG + Intergenic
1050317950 9:4422735-4422757 GAGATAAAGTGTGAAAGTCAGGG + Intergenic
1052005552 9:23343746-23343768 GATCTAGGGTTTTATAATCAGGG + Intergenic
1057887830 9:98844602-98844624 GACCCAAGGTGTTAGAGGCAGGG - Intronic
1059522311 9:114955111-114955133 CAACTCAGCTGTTAAAGTCATGG + Intergenic
1059532426 9:115048167-115048189 GAACAAAGATGTTAAAGTCATGG + Intronic
1061361313 9:130144094-130144116 GTTATAAGCTGCTAAAGTCAAGG - Intergenic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1185743930 X:2556138-2556160 GATCTATGGTATTCAAGTAACGG + Intergenic
1185912571 X:3998859-3998881 TGTCTAAGGTGTTAAATTCTGGG - Intergenic
1186593003 X:10951215-10951237 GAGCTAAGGTGATGACGTCAAGG + Intergenic
1187058751 X:15765698-15765720 CATCTAGTGTGTCAAAGTCAGGG + Intronic
1194416018 X:93612999-93613021 GAACTCAGGTGTCAAAGACAGGG - Intergenic
1197271551 X:124429802-124429824 CACCTAATGTGTAAAAGTCAGGG - Intronic
1199820946 X:151445347-151445369 CATCTAAGGTGTTAAATTTATGG + Intergenic