ID: 949192436

View in Genome Browser
Species Human (GRCh38)
Location 3:1266629-1266651
Sequence ATGAATAAAAGGGCTTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949192436 Original CRISPR ATGAATAAAAGGGCTTATTA AGG Intronic
903177902 1:21591500-21591522 ACGAATAAAAAGGCTGTTTAAGG + Intergenic
904232067 1:29083022-29083044 CTGGATAAAGGGGCTTATTCCGG - Intronic
906465070 1:46071273-46071295 ATGCATAAATGGGATTTTTATGG - Intronic
906649354 1:47501657-47501679 ATGAATACAAGGGCATTTTAGGG - Intergenic
907582859 1:55587668-55587690 ATAAATAAAAGAGGTAATTAAGG - Intergenic
907599984 1:55759408-55759430 ATGAATAAAAGTGCATATTCTGG - Intergenic
908082060 1:60591234-60591256 ATGAATAAAATGCCTATTTATGG + Intergenic
909604339 1:77493468-77493490 ATGTATATATGGGCTTATAATGG + Intronic
909939170 1:81590690-81590712 ATGCAAAAATGGGTTTATTATGG - Intronic
909978755 1:82072869-82072891 ATGAACAAAAAGGTTGATTATGG + Intergenic
911485826 1:98503952-98503974 ATGAAAAGAAGGGCTTAAGATGG - Intergenic
911962723 1:104327173-104327195 ATGTACAGAAGGGCTTATTCAGG + Intergenic
911962854 1:104329266-104329288 ATGTACAGAAGGGCTTATTCAGG + Intergenic
914576913 1:148980610-148980632 AAGAATAAAAGGGGCTAGTAGGG - Intronic
916220200 1:162436137-162436159 ATGAATAAAAGGACTTGATTTGG - Intergenic
916403299 1:164471881-164471903 ATGTTTAAAATGGGTTATTAAGG + Intergenic
916970970 1:170015662-170015684 AGGCATAAAAGAGCTTATTTAGG + Intronic
916971131 1:170017498-170017520 AGGAATAAAAGAGCCTGTTAGGG + Intronic
917229246 1:172818321-172818343 AAGAATAAAAGAGATTAATAAGG - Intergenic
918745369 1:188191416-188191438 ATGAATAAAAGCCGTTATCAAGG + Intergenic
918920988 1:190709306-190709328 ATGAATAAGAGGAATTTTTATGG - Intergenic
919268614 1:195308663-195308685 ATGAATATAAGTGCTAATTATGG - Intergenic
919469424 1:197959882-197959904 ATTATTATAAGGCCTTATTAGGG + Intergenic
920225521 1:204435894-204435916 ATGAATAAAAGCACTTAATAAGG + Intronic
920522363 1:206637093-206637115 AGAAATAAAAGGCCTTTTTAAGG - Intronic
920596328 1:207274700-207274722 AGGAAGAAAAGGGCTTTTTTTGG + Intergenic
920691170 1:208147433-208147455 ATGAAAAAAAGGGGTTATCCTGG - Intronic
924396430 1:243626069-243626091 ATGATTTAAAGGGCATATTAAGG - Intronic
1062809775 10:454206-454228 ATTAAGAGAAGGGCTTATTCAGG + Intronic
1063582214 10:7318272-7318294 ATATCTAAAAGGGCTTCTTAGGG - Intronic
1064393405 10:14960241-14960263 AGGAATAAAAGGGACTATTAGGG + Intronic
1064524317 10:16237458-16237480 ATGATTAAAAGGGCATAAAAAGG + Intergenic
1065049101 10:21772543-21772565 ATAAATAAAAAGGATTATAAAGG - Intronic
1066202611 10:33156662-33156684 ATGAATATCAGGGCACATTATGG - Intergenic
1067019985 10:42786920-42786942 ATGAATAAAAGTGCTCAAAAAGG - Intronic
1067180076 10:43978789-43978811 ATGAAGAAAATGGCTTCTTTTGG + Intergenic
1069171586 10:65237167-65237189 ATGAATAAAAAGGCATGTTATGG - Intergenic
1069414262 10:68184278-68184300 GTGAAGAAAAGGGCATATCAAGG - Intronic
1070270474 10:74949535-74949557 ATTTATAAAAGTGCTGATTAAGG - Intronic
1073423063 10:103439988-103440010 ATGAATAAAAGGCCTTTGTTTGG + Intronic
1077149471 11:1063622-1063644 ATGAAAGAAGGGGCTTATGAAGG + Intergenic
1079927413 11:26511750-26511772 GTGAATAAAAGGGCTAGATATGG + Intronic
1080007113 11:27421290-27421312 ATGAATCTAAGGGTTTCTTAGGG - Intronic
1081123438 11:39293565-39293587 ATGAATATAAGGGCATATTAAGG - Intergenic
1081338728 11:41901493-41901515 ATGAAATAAAGAGCATATTATGG - Intergenic
1081556311 11:44165229-44165251 ATGCAAATAAGTGCTTATTATGG - Intronic
1082221662 11:49646087-49646109 ATGAATAAAACCACTGATTATGG - Intergenic
1085257923 11:75187034-75187056 CTGACAAAAAGGGATTATTATGG + Intronic
1085372640 11:76023935-76023957 ATGAAAAACATGGCTTATAAGGG + Intronic
1085576878 11:77613411-77613433 ATGAAAAAAATGGATTATTTTGG - Intronic
1085723860 11:78936941-78936963 ATGCAAAAAAGGGTTAATTAAGG + Intronic
1086146747 11:83560583-83560605 AAGAAATAAAGGGCTGATTAAGG + Intronic
1086627371 11:88973071-88973093 ATGAATAAAACCACTGATTATGG + Intronic
1086804977 11:91229710-91229732 ACCAATAAAAGGGAGTATTAAGG + Intergenic
1087238377 11:95747462-95747484 ATGATAAAAAGAGATTATTATGG - Intergenic
1087983954 11:104653954-104653976 ATGAATAAAAGGACTAGTTCAGG - Intergenic
1088846853 11:113675462-113675484 AAGACAGAAAGGGCTTATTAAGG - Intergenic
1089123550 11:116160161-116160183 ATGAATCAAGGGGCCTATTTGGG + Intergenic
1089648816 11:119898314-119898336 ATGAATAAATAGTCTTATAAAGG - Intergenic
1091159268 11:133405088-133405110 CTCAGTAAAAGGGATTATTAAGG + Intronic
1091359835 11:134969827-134969849 ATGAATTAGAGGACTTAATATGG + Intergenic
1093581772 12:20791523-20791545 CTTACAAAAAGGGCTTATTAAGG + Intergenic
1094099784 12:26749696-26749718 ATGAAGAAAATGGAATATTAAGG - Intronic
1094247393 12:28315024-28315046 ATGAATGTAAATGCTTATTATGG - Intronic
1094252534 12:28380582-28380604 ATGAATAAATAATCTTATTATGG - Intronic
1094313648 12:29114142-29114164 AGAAAGAAAAGGGCTTATTTGGG + Intergenic
1094634259 12:32209199-32209221 ATTAATAAAAATCCTTATTAAGG - Intronic
1096877405 12:54640990-54641012 AGGAAAAAAAGGGCATGTTATGG + Intergenic
1097034668 12:56115664-56115686 AAGAATAAAATAGCTGATTATGG - Intergenic
1098171124 12:67748327-67748349 ATCTATGAAAGGGCGTATTAAGG + Intergenic
1098321552 12:69249313-69249335 ATAAATAAAAGATCTTATTCTGG + Intronic
1098696339 12:73560986-73561008 TTGAATAAAAGGTTGTATTAGGG + Intergenic
1099330415 12:81278138-81278160 ATGGAGAAAAGGGCATATTAAGG + Intronic
1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG + Intergenic
1103286532 12:119806281-119806303 TTGAAAAGAAGGGCTTCTTAGGG + Intronic
1106757103 13:32832761-32832783 AGAAATAAAAGGGATTATAAAGG - Intergenic
1110056590 13:70981788-70981810 ATAAATTAAATGGCTTATTTTGG + Intergenic
1111608837 13:90577015-90577037 ATGAATAAAAATGTTTACTAGGG + Intergenic
1112977998 13:105345020-105345042 TTGAAGAAAAGGGTTTCTTAAGG - Intergenic
1114161021 14:20167598-20167620 ATTATTAAAAGGGGTTATCAAGG + Intergenic
1116264250 14:42666213-42666235 ATGAATAAATGCTCTAATTAAGG - Intergenic
1116764932 14:49058911-49058933 ATATACAAAAGGGTTTATTAAGG + Intergenic
1116985863 14:51219416-51219438 ATGAAACAAAGAGTTTATTAAGG - Intergenic
1118797876 14:69160515-69160537 AGAAATAAAAGGGATTATAAGGG - Intergenic
1118802104 14:69200251-69200273 AGGTATAATAGGGCTTATCAGGG + Intronic
1119568776 14:75651442-75651464 GTGAATAAAAGGGCAGATGATGG + Exonic
1120038025 14:79720310-79720332 ATGCATCAAGGGGATTATTAAGG - Intronic
1120195343 14:81476307-81476329 AAGAATGAAAGGCCTTGTTAAGG - Exonic
1121169355 14:91840388-91840410 ATTTATCAAAGAGCTTATTAAGG + Intronic
1124877226 15:33606520-33606542 ATGGCTAAAAAGGCCTATTAAGG - Intronic
1125347053 15:38728898-38728920 ATGACTAAAAGGACTTTATAGGG - Intergenic
1125378094 15:39055043-39055065 ATGCATAAAAGTGTTTATGACGG - Intergenic
1125431372 15:39597741-39597763 AAGAATAAAATTTCTTATTAAGG + Exonic
1126147730 15:45492635-45492657 AAGAAGAAAAGAGCTTATTCTGG + Intronic
1126194253 15:45913754-45913776 ATGACAAATAGGGCTTATTAAGG - Intergenic
1127092756 15:55482827-55482849 ATGAATAATATGGCATAGTATGG - Intronic
1127953327 15:63832026-63832048 ATGGATTAAATGGCCTATTAAGG - Intronic
1128731075 15:70021627-70021649 ATCAATAAAAGGGATAATAAAGG + Intergenic
1131939836 15:97548860-97548882 AAAAATAAAAGTGCTTATAAGGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1138364239 16:56460381-56460403 ATGAATAGAAGAGCTTTTTCTGG + Intronic
1138499739 16:57432790-57432812 ATGTATATAAGTGCTTAATATGG - Intronic
1138869296 16:60861978-60862000 ATCAATAAAGGGGTTTATGATGG - Intergenic
1141358412 16:83371414-83371436 AAGAGGAAAAGGGCTTATAATGG - Intronic
1146785367 17:35715691-35715713 GTGATTAAAAGGGCATATTGAGG + Intronic
1148338279 17:46856285-46856307 ATGAATGAAAGGGCTGGATAGGG + Intronic
1148522789 17:48297759-48297781 AAGAACAAAAGGGCCTATAAGGG + Intronic
1149965224 17:61155836-61155858 ATGATTAAAAGGCCTTAACAAGG - Intronic
1154495266 18:14952190-14952212 ATGAATTAGAGGACTTAATATGG - Intergenic
1154954941 18:21243600-21243622 ATGAATGAGAGGTTTTATTAAGG - Intronic
1155332865 18:24735226-24735248 AAGAAAAAAAGCACTTATTATGG - Intergenic
1155701701 18:28752369-28752391 ATCAATAAAAGTGTTTACTACGG - Intergenic
1160654541 19:257579-257601 ATGAATAAAAGGGTTTACAAGGG + Intergenic
1161275802 19:3416199-3416221 ATGTTTAAAAGGGCTCTTTATGG - Intronic
1161902087 19:7126461-7126483 ATGAATAAGAGGGCTTTTCTTGG + Intronic
1163994210 19:21027911-21027933 ATGAATATAAGAGTTTATTTGGG - Intronic
1164997564 19:32733717-32733739 CTGAATAAAAGAGCTGATTCAGG - Intronic
1167777549 19:51570511-51570533 ATTAAAAAAATGGCTGATTATGG - Intergenic
1167949670 19:53016083-53016105 ATGAACAAAATGGTATATTAGGG - Exonic
926498704 2:13624841-13624863 ATTAATAAATGAGTTTATTAAGG + Intergenic
926590358 2:14734100-14734122 AAGATAAAAAGGGGTTATTAGGG - Intergenic
928706296 2:33953116-33953138 ATGAAAAAGAGGGCTTATGAAGG - Intergenic
929477618 2:42268011-42268033 ATGTATAAAATTGCTTATTGTGG + Intronic
933032362 2:77346064-77346086 ATGAATAAAAGGAGGTACTATGG + Intronic
933088232 2:78084878-78084900 ATAAATAAAAGGGATAATGAAGG + Intergenic
933863956 2:86499313-86499335 ATGAATAAATGGTTTTATTAGGG + Intergenic
934914680 2:98291519-98291541 ATGCATAAAGGGTCATATTAAGG + Intronic
935047423 2:99494668-99494690 ATCAATAAAATGGTTTATTCAGG - Intergenic
935185074 2:100724384-100724406 ATCTATAAAAGGGATTTTTAAGG + Intergenic
935761244 2:106322442-106322464 AGTAAGCAAAGGGCTTATTAAGG - Intergenic
936480877 2:112883850-112883872 ATTACTAAAAGGGCATATCAGGG + Intergenic
937106516 2:119320351-119320373 AGGAATAAAAAGGATGATTAAGG - Intronic
939395137 2:141619257-141619279 ATGAATGAAAGTGCTAAGTACGG - Intronic
939772841 2:146344603-146344625 ATGAATAATGGGGCCTATTTGGG - Intergenic
941081167 2:161062152-161062174 ATGAATTAAAGGGAATCTTAGGG - Intergenic
941319534 2:164037909-164037931 AGGAAAAAAAGGCCTTATGATGG + Intergenic
941405940 2:165088465-165088487 ATGAATAAAAGGTTATATTGAGG + Exonic
942586614 2:177486307-177486329 ATGGATAAAAGGTTTTATAATGG + Intronic
942773014 2:179545559-179545581 AAGACTAAAAGGGTTGATTATGG + Intronic
943409630 2:187530914-187530936 ATGAATAAAAGTGAATATAATGG + Intronic
944411800 2:199452514-199452536 AGGAAAAGAAGGGATTATTAAGG - Intronic
944562501 2:200954788-200954810 ATGTCTAAAAAGGCTAATTAGGG + Intronic
944784048 2:203049701-203049723 ATAAATAAAAGAGCTTCTTTAGG + Intronic
945499983 2:210560203-210560225 ATGAATGAAATAGGTTATTATGG - Intronic
945570593 2:211462555-211462577 AGGAAGAAAAGGGTTTTTTAAGG + Intronic
946842461 2:223832089-223832111 ATCAAAAAAAGGACTTATTCTGG + Intronic
1169371109 20:5028703-5028725 ATAAATACAAGGGTTTATTTTGG + Intergenic
1173492603 20:43495334-43495356 ATATAAAAAAGGGTTTATTAGGG + Intergenic
1174046095 20:47734841-47734863 TTGAATAAAAGCACTTATTTAGG + Intronic
1174751253 20:53113403-53113425 ATAAATAAATGGGTTTAATATGG - Intronic
1176890229 21:14307706-14307728 GTGAAGAAAAGTGCTTATTAAGG + Intergenic
1177382066 21:20357374-20357396 TTAAATAAATGGGCTTATTTTGG + Intergenic
1178220699 21:30655652-30655674 AGAAATAAAAGGGATTATAAGGG + Intergenic
1182324593 22:29502775-29502797 ATAAATAAAAGGGTTTACTGTGG - Intergenic
1185175894 22:49326429-49326451 ATGAATAATCGGTCCTATTAAGG + Intergenic
949192436 3:1266629-1266651 ATGAATAAAAGGGCTTATTAAGG + Intronic
949587110 3:5452366-5452388 ATAAAGAAAAAGGCTTATTCTGG + Intergenic
953353935 3:42238397-42238419 AGGAGAAAAAGGGTTTATTAAGG + Intergenic
955608273 3:60730441-60730463 AAGAATAAAAGGATTTATAAAGG - Intronic
956412657 3:68994860-68994882 ATGAATAAAAGGAGAAATTACGG - Intronic
958933622 3:100233962-100233984 ATGAATAGAAGGGCTGAAGACGG + Intergenic
959807647 3:110576559-110576581 GTGAACCAGAGGGCTTATTAAGG - Intergenic
959975032 3:112449061-112449083 ATGAATAAAAGTCCCTATTGAGG - Intergenic
960511335 3:118552985-118553007 ATGAATCCTAGGGCTTATTCAGG + Intergenic
960797600 3:121504234-121504256 ATAAATAAAAAGGATTATAAGGG + Intronic
963344693 3:144080896-144080918 ATGTTTAAAAAGCCTTATTAAGG + Intergenic
965437820 3:168674298-168674320 CAGAATAAAAGAGCTTAATATGG - Intergenic
965648779 3:170911447-170911469 CTGAAAAAAGGGGCTTATTTAGG + Intergenic
967329015 3:188271906-188271928 ATGAATAAAAGGGACTATTATGG - Intronic
967434068 3:189424367-189424389 ATAAATAAGAGGGCTTGTTTTGG - Intergenic
970069762 4:12144402-12144424 GTGGATAAAAGGGCTTATGGGGG - Intergenic
970486946 4:16534328-16534350 ATGAACAAGATGGCTTAGTAGGG + Intronic
970750957 4:19360391-19360413 ATGAAAAAAAGGCCTCATAATGG + Intergenic
973018963 4:45175756-45175778 ACAAATAAAAGTGCTTAATATGG + Intergenic
974436875 4:61867922-61867944 ATAAAGAGAAGGGCTTATAATGG + Intronic
975442198 4:74423851-74423873 ATGAATAAAAGGGCTTAATACGG - Intergenic
977638075 4:99323696-99323718 ATGTATAAAAGGGGGTATTAGGG - Intergenic
978426086 4:108584047-108584069 ATTAAAAAAATGGCCTATTAGGG + Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
980402052 4:132303366-132303388 ATGAATTAAAGGGTTTGTTTAGG + Intergenic
983491446 4:168394464-168394486 CTTTGTAAAAGGGCTTATTAGGG - Exonic
983637856 4:169916510-169916532 ATGAAGAAAAAGGCTTATGAAGG - Intergenic
983796890 4:171875240-171875262 AAGAAGCAAAGGGCTTATTAAGG + Intronic
985895951 5:2750297-2750319 ATGAATTAAAATGCTAATTACGG - Intronic
986717564 5:10535039-10535061 ATGAATGAAATGGCTTGTGATGG - Intergenic
987539467 5:19235339-19235361 ATGTATAAAGGAGTTTATTAAGG - Intergenic
988250485 5:28751048-28751070 ATGAACAAAATGGCCTATTCTGG + Intergenic
990941620 5:61207843-61207865 GTCAATAAAAGGTCCTATTACGG + Intergenic
992434778 5:76745559-76745581 AAAAATAAAATGGCTTATTGTGG - Intergenic
993214967 5:85008650-85008672 TTGAATAAAAGGGCATTTTCAGG + Intergenic
993866406 5:93201732-93201754 ATGAATAAAAGATCTAACTAAGG + Intergenic
994053515 5:95389580-95389602 ATGAATTAAAGCCCTTATTGTGG - Intergenic
996809450 5:127499449-127499471 ATAAATAAAAAGGATTATGAAGG + Intergenic
998700276 5:144690487-144690509 ATGAATAAATGAAATTATTAGGG - Intergenic
999185530 5:149704964-149704986 ATAAATAAAATGGATTATAAAGG - Intergenic
1000151561 5:158506562-158506584 AGGAATAAAAGGGAGTATAAGGG + Intergenic
1000937466 5:167320359-167320381 AAGAAGAAATGGGCTTATTCAGG + Intronic
1002000570 5:176194428-176194450 AAGAAGAAAAGCGCTTATCAGGG + Intergenic
1002272757 5:178083554-178083576 ATGTAGAAAAGGGCTGATAAGGG + Intergenic
1002631659 5:180585145-180585167 TAGAATAAAAAGGATTATTATGG + Intergenic
1006206457 6:32347656-32347678 ATGAAAACAATGGCTTATTGTGG + Intronic
1007364018 6:41377544-41377566 ATGGCTAAAAGGGATTATGAAGG + Intergenic
1008227733 6:48942273-48942295 ATGAAAGAAATGGCTTATGAAGG + Intergenic
1009380490 6:63022933-63022955 GTGAATAGAATGGCTCATTAAGG + Intergenic
1011216959 6:85015195-85015217 CTAAATCAAAGGGATTATTAAGG + Intergenic
1013915288 6:115329888-115329910 ATGAATAAAAGTGAATATTGAGG - Intergenic
1017379307 6:153809863-153809885 ATGAATAAATGAGTTTAGTACGG - Intergenic
1018468484 6:164074602-164074624 ATCAATAAAAGCGCAAATTATGG - Intergenic
1019192493 6:170260957-170260979 ATGAATAAACGGGCTCTTCAAGG + Intergenic
1020044363 7:5029987-5030009 ATAAATAGAAGAGATTATTATGG + Intronic
1020932373 7:14413977-14413999 TTGAATAAAAGGACTTAGTGTGG - Intronic
1021036558 7:15807339-15807361 ATGAAGAAATGGGATTATTGTGG + Intergenic
1023462802 7:40418879-40418901 ATGAATTATAGTGCTTAATATGG - Intronic
1023825989 7:44009380-44009402 ATAAATAGAAGAGATTATTATGG - Exonic
1024694452 7:51840526-51840548 AAGAACAAAAGTGCTAATTATGG + Intergenic
1024925135 7:54604598-54604620 ACGAATAAACAGGCTGATTAAGG - Intergenic
1025077454 7:55955308-55955330 ATGAAGTAAAGGGCATACTATGG + Exonic
1026089556 7:67288232-67288254 ATAAATAGAAGAGATTATTATGG - Intergenic
1026724726 7:72862272-72862294 ATAAATAGAAGAGATTATTATGG + Intergenic
1026746860 7:73020471-73020493 ATAAATAGAAGAGATTATTATGG + Intergenic
1026750512 7:73048614-73048636 ATAAATAGAAGAGATTATTATGG + Intergenic
1026754159 7:73076724-73076746 ATAAATAGAAGAGATTATTATGG + Intergenic
1026757810 7:73104757-73104779 ATAAATAGAAGAGATTATTATGG + Intergenic
1026813518 7:73490566-73490588 ATGAATACAAGGGATACTTAGGG + Intronic
1027032964 7:74905042-74905064 ATAAATAGAAGAGATTATTATGG + Intergenic
1027089593 7:75288727-75288749 ATAAATAGAAGAGATTATTATGG - Intergenic
1027093238 7:75316655-75316677 ATAAATAGAAGAGATTATTATGG - Intergenic
1027096881 7:75344622-75344644 ATAAATAGAAGAGATTATTATGG - Intergenic
1027119151 7:75503548-75503570 ATAAATAGAAGAGATTATTATGG - Intergenic
1027272676 7:76532058-76532080 ATAAATAGAAGAGATTATTATGG + Intergenic
1027322467 7:77023058-77023080 ATAAATAGAAGAGATTATTATGG + Intergenic
1027894152 7:84019294-84019316 ATGAATAAAAAAGCTTAGGAAGG + Intronic
1027942505 7:84702172-84702194 ATGAACAAAAGGGCAAATGAAGG - Intergenic
1028804426 7:95008275-95008297 ATTCATAAAAGGGGTTTTTAGGG + Intronic
1029397990 7:100321598-100321620 ATAAATAGAAGAGATTATTATGG - Exonic
1029718345 7:102346492-102346514 ATAAATAGAAGAGATTATTATGG + Intergenic
1029754271 7:102562764-102562786 ATAAATAGAAGAGATTATTATGG - Intronic
1029772221 7:102661854-102661876 ATAAATAGAAGAGATTATTATGG - Intronic
1030148072 7:106376559-106376581 TAGAATAAAAGAGCTAATTAAGG - Intergenic
1031140802 7:117941053-117941075 TTGGATAAAAGGACTTATTCAGG - Intergenic
1031415211 7:121487935-121487957 ATGTCTAAAAAGGCTTGTTAGGG + Intergenic
1031479777 7:122264703-122264725 AAGAATAAAATGGCTCCTTATGG + Intergenic
1031748511 7:125538040-125538062 GTGACTAAAATGTCTTATTATGG + Intergenic
1036983302 8:13495850-13495872 AAAAATAAAAGAGCTTATAAGGG - Intronic
1037169163 8:15869466-15869488 ATCACTAGAAGGTCTTATTATGG + Intergenic
1038829472 8:31041332-31041354 ATAAATAAAAAGGCTAAGTAAGG - Intronic
1038866882 8:31448622-31448644 ATGGATCAGAGGGCTTAATATGG + Intergenic
1040651517 8:49454362-49454384 ATAAATAAAACTGCTTATGATGG - Intergenic
1040922406 8:52636904-52636926 ATGAATACGAGGGCTAATTTTGG + Intronic
1043715027 8:83471985-83472007 CTCAATGAAAGGGCTTATTTTGG + Intergenic
1045417400 8:101980839-101980861 ATAAATAATAGGGCTTAAAATGG - Intronic
1045723962 8:105148999-105149021 ATGCAACGAAGGGCTTATTAAGG + Intronic
1045921489 8:107535285-107535307 ATGAATAAATGAACTCATTAAGG + Intergenic
1046123979 8:109881468-109881490 ATTGATAAATGGACTTATTATGG - Intergenic
1046453891 8:114433244-114433266 ATAAACAAGAGGACTTATTATGG - Intergenic
1047636537 8:126769075-126769097 TTCAACCAAAGGGCTTATTAAGG - Intergenic
1048033185 8:130652183-130652205 AGGAATAAAAGGGATAATCATGG - Intergenic
1050611815 9:7361411-7361433 ATGAGTAAAATGGTTTTTTAAGG + Intergenic
1050683120 9:8137237-8137259 AGGACTAATAGGGCTCATTATGG - Intergenic
1052412256 9:28136908-28136930 ATGAACAAAAAGGCTGAGTAAGG + Intronic
1052465424 9:28823242-28823264 ATAAATAAAAGGATATATTATGG + Intergenic
1056080524 9:83089431-83089453 AACACTAAAAGGGCTTTTTAGGG - Intergenic
1058344163 9:103939907-103939929 ATGAATCAAAGATCTTAATATGG + Intergenic
1060060727 9:120457149-120457171 ATGAAGAAATGGGCTCATAAAGG + Intronic
1062720018 9:138035607-138035629 AGGGAAAAAAGGGCTTATCAAGG - Intronic
1185452431 X:289946-289968 ATGAATGAATGTGATTATTAGGG - Intronic
1188734715 X:33698188-33698210 ATGAAAAAAATGGCTTGTTGAGG - Intergenic
1190471547 X:50785266-50785288 ATGAATAGAATGGCTCATCATGG - Intronic
1193956344 X:87868701-87868723 ATGAAAGAAAGGGCATTTTAGGG + Intergenic
1194049018 X:89045212-89045234 AAAAATAAAAAGGATTATTAGGG - Intergenic
1196129640 X:112141272-112141294 ATGAATGAATGGGCTTAGTAAGG - Intergenic
1196780576 X:119380239-119380261 ATGAAGTAAAGGGCATATTATGG + Intergenic
1198317052 X:135478347-135478369 ATGAAAGAAAGGGCTTAGGAAGG - Intergenic
1198789409 X:140327308-140327330 ATGAATGCAAGAGCTTTTTATGG - Intergenic
1198893016 X:141420868-141420890 ATAAATATGAGGGCTTATTCTGG - Intergenic
1201713676 Y:17019625-17019647 ATGAATAAATTGTTTTATTAAGG + Intergenic