ID: 949194821

View in Genome Browser
Species Human (GRCh38)
Location 3:1292183-1292205
Sequence GTAGGACTCGTGGCTGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949194821_949194827 5 Left 949194821 3:1292183-1292205 CCTCCAGCAGCCACGAGTCCTAC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 949194827 3:1292211-1292233 CCTTCTGGACATTGATAGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 126
949194821_949194828 6 Left 949194821 3:1292183-1292205 CCTCCAGCAGCCACGAGTCCTAC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 949194828 3:1292212-1292234 CTTCTGGACATTGATAGAGAGGG 0: 1
1: 0
2: 3
3: 16
4: 190
949194821_949194824 -10 Left 949194821 3:1292183-1292205 CCTCCAGCAGCCACGAGTCCTAC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 949194824 3:1292196-1292218 CGAGTCCTACTTTTGCCTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949194821 Original CRISPR GTAGGACTCGTGGCTGCTGG AGG (reversed) Intronic