ID: 949196066

View in Genome Browser
Species Human (GRCh38)
Location 3:1309511-1309533
Sequence CCTCAATTACTGTAGCTTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 7, 3: 54, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949196063_949196066 -9 Left 949196063 3:1309497-1309519 CCATTACCACATTGCCTCAATTA 0: 1
1: 0
2: 5
3: 63
4: 461
Right 949196066 3:1309511-1309533 CCTCAATTACTGTAGCTTTACGG 0: 1
1: 1
2: 7
3: 54
4: 221
949196062_949196066 14 Left 949196062 3:1309474-1309496 CCATTGCTCTGTCTATTCTTTTG 0: 1
1: 0
2: 4
3: 72
4: 707
Right 949196066 3:1309511-1309533 CCTCAATTACTGTAGCTTTACGG 0: 1
1: 1
2: 7
3: 54
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949196066 Original CRISPR CCTCAATTACTGTAGCTTTA CGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900827397 1:4937771-4937793 ACTCAATTGCTGTACCTTTTGGG - Intergenic
901406358 1:9049387-9049409 TCTTGATTACTGTAGCTTTATGG - Intronic
902256429 1:15191852-15191874 AGTCAATTACTGTAGCTTTCTGG - Intronic
904085090 1:27900622-27900644 ACTGAATTGCTGTAACTTTATGG + Intronic
906987239 1:50696480-50696502 CCTCAATTACTTAAACTTTGTGG + Intronic
907690899 1:56664999-56665021 CCTCAATTGCTTTATCTTTTAGG + Intronic
909681814 1:78300216-78300238 CCTCTATTCCTGTAGGTTTCAGG - Intergenic
909841322 1:80328962-80328984 CCTTGATTACTGTAGCTCTGTGG - Intergenic
910567333 1:88658996-88659018 CCTAAATTACGTTAGCTTTAGGG - Intergenic
910885114 1:91955920-91955942 CCTCAATTACAGTGTATTTAAGG + Intronic
911185995 1:94905510-94905532 ACTAAATTACTGTGGCATTAGGG + Intronic
911695691 1:100888787-100888809 TGTCAATTACTGAAGCTATAAGG - Exonic
911703655 1:100985520-100985542 TCTTAATTACTTTAGCTTTATGG - Intergenic
912049347 1:105505379-105505401 TCTGAATTACTATAGCTTTGAGG - Intergenic
912479766 1:109973181-109973203 TTTCAATTACTGTAGCTTTGTGG + Intergenic
914371974 1:147033554-147033576 CTTCCATTACGGCAGCTTTAAGG + Intergenic
915321019 1:155056566-155056588 CCTCTATACCTGTAGCTTTGGGG - Intronic
917172182 1:172189247-172189269 TCTTTATTACTATAGCTTTATGG + Intronic
918549103 1:185719406-185719428 CCTCAGTTTCCTTAGCTTTAAGG + Intergenic
921087305 1:211807509-211807531 TCTTAATTATTGTAGTTTTATGG - Intronic
924184145 1:241469545-241469567 CCTCATTTACTGCTGTTTTATGG - Intergenic
924528592 1:244873886-244873908 CCTCAGTGACTGGTGCTTTATGG - Intergenic
1062801066 10:380764-380786 CCTCACTTAGTACAGCTTTACGG + Intronic
1065383636 10:25113656-25113678 CCACATTGACTGTAGTTTTACGG + Intergenic
1066485624 10:35840723-35840745 TCTTGATTACTGTAGGTTTACGG + Intergenic
1067178590 10:43968333-43968355 CCTCAATGTTGGTAGCTTTAGGG - Intergenic
1067248630 10:44568519-44568541 CTGGAATTACTGTAGCTCTATGG + Intergenic
1067290978 10:44940266-44940288 CATGTATTACTGTAGCTTTGTGG + Intergenic
1073934156 10:108610711-108610733 CCTTGATTACTGTAGCTATCTGG - Intergenic
1076134416 10:128035831-128035853 CCTCAATAATTGGAGCTTTCAGG - Intronic
1076271086 10:129152733-129152755 CCTGAATTTCTGTATGTTTAAGG + Intergenic
1078060967 11:8043317-8043339 CCTTGATTACTGGAGCTTTGTGG + Intronic
1078643978 11:13121427-13121449 ACTCAATTACTGTAGCTTTGTGG + Intergenic
1081860740 11:46332328-46332350 CCTGAATTACTGAGGCTTCAGGG - Intergenic
1085275625 11:75297327-75297349 TCTTGATTACTGTAGCTTTGTGG - Intronic
1087134545 11:94702899-94702921 TCTTGATTACTATAGCTTTAGGG - Intergenic
1090577500 11:128122790-128122812 TCTAGATTACTGTAGCTTTGTGG - Intergenic
1091423361 12:363370-363392 TCTTGAGTACTGTAGCTTTATGG - Intronic
1091573185 12:1709048-1709070 ACTTGATTACTGTAGCTTTATGG + Intronic
1092095067 12:5834967-5834989 CATCCATTACAGTAGCTGTATGG - Intronic
1092110739 12:5962436-5962458 TCTTGATTACTGTAACTTTATGG - Intronic
1093256695 12:16876442-16876464 CCTCCATTGCTGTTGCTTTTAGG - Intergenic
1093738239 12:22649601-22649623 CCTTAATTGCTATAGCTTTATGG + Intronic
1094467935 12:30773770-30773792 CTTCTAATACTGTGGCTTTAGGG + Intergenic
1095457632 12:42405745-42405767 CCTCAATTACTGGAACTTGGGGG + Intronic
1096632131 12:52934634-52934656 TCTTGATTACTGCAGCTTTATGG - Intronic
1098292904 12:68975285-68975307 CCTTAAATACTATAGCTTTATGG + Intergenic
1098697381 12:73576335-73576357 TCTTGATAACTGTAGCTTTATGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1103268762 12:119654610-119654632 TCTCAATTACTGTAATTTTATGG - Intergenic
1104130414 12:125888073-125888095 TTTTGATTACTGTAGCTTTATGG + Intergenic
1104836150 12:131792932-131792954 CCTTGGTTACTGTAGCTTTCTGG - Intronic
1105053367 12:133075467-133075489 TCTTAATTACTGTAGCTTTCTGG - Intergenic
1105709393 13:22992060-22992082 CCTCAACTACTGAACCTTAAAGG + Intergenic
1105714102 13:23044639-23044661 TCTTATTTATTGTAGCTTTATGG + Intergenic
1106206906 13:27606472-27606494 CCTTAATTAATGTAACCTTAAGG - Intronic
1106218163 13:27721538-27721560 ACTGACTTACTGTGGCTTTAGGG - Intergenic
1106556635 13:30814856-30814878 TCCTGATTACTGTAGCTTTATGG + Intergenic
1107111733 13:36705231-36705253 CATCAGTTACTGTATCTTTGGGG - Intergenic
1107909548 13:45092510-45092532 ACTAAATTAATGTAGCTTAAGGG + Intergenic
1109784438 13:67155997-67156019 GCTCAAATACAGTATCTTTAAGG + Intronic
1109941005 13:69364690-69364712 CCTCAATTACTGTTTTTTTTAGG + Intergenic
1110128312 13:71976063-71976085 TCTCAATTGCTGTATCTTTCGGG - Intergenic
1111525460 13:89462487-89462509 TCTCAACTACAGTAGTTTTAAGG - Intergenic
1111646976 13:91043386-91043408 CTTCAATTTCCGTGGCTTTAGGG - Intergenic
1111865712 13:93765685-93765707 CCTGTATTTCTGTAGCTTTAGGG - Intronic
1111956556 13:94765359-94765381 CCTAATTAACTGTAGCCTTAAGG - Intergenic
1112141584 13:96649636-96649658 CCTCCATTACTGTATCCTGATGG + Intronic
1113779499 13:112968253-112968275 CCTGAAATACTGTTTCTTTAAGG + Intronic
1116304519 14:43233527-43233549 GTTAAATTACTGTGGCTTTAGGG - Intergenic
1118090997 14:62477872-62477894 TCTTAATTACTTTAGCTTTATGG + Intergenic
1118119447 14:62822370-62822392 TCTTAATTACTATAGCTATAAGG - Intronic
1119763030 14:77166735-77166757 TTTCAATTACTGAAGCTTTGTGG + Intronic
1119873868 14:78039999-78040021 TCTTTATTATTGTAGCTTTATGG + Intergenic
1120079000 14:80193942-80193964 TCTTGACTACTGTAGCTTTATGG - Intergenic
1121146201 14:91584502-91584524 CCTCCATTCCTGAAGCTTCAAGG + Intronic
1121385290 14:93516217-93516239 TCTTGATTACTGTAGCTTTACGG + Intronic
1123047009 14:105522739-105522761 TCTCAATTGCTTTAGCTTTATGG + Intergenic
1123708745 15:22970544-22970566 TTTCAATTACTGTAGCTTTATGG - Intronic
1124064517 15:26328435-26328457 TCTTGATTAGTGTAGCTTTATGG - Intergenic
1124571507 15:30868349-30868371 CACTAATCACTGTAGCTTTATGG - Intergenic
1125400425 15:39296313-39296335 CCTCAATTCCTTTATCTATAAGG + Intergenic
1127003428 15:54537586-54537608 TTTTGATTACTGTAGCTTTATGG - Intronic
1127167353 15:56259626-56259648 CATTAAATATTGTAGCTTTATGG + Intronic
1127393448 15:58525328-58525350 CTTGAATTACTGAATCTTTACGG + Intronic
1129950383 15:79582842-79582864 TCTCAATTACTGTTGCTTTGTGG + Intergenic
1130448404 15:84026550-84026572 TCTTGATTACTGTAGCTTTTTGG - Intronic
1137963552 16:52909298-52909320 CCTCATTGATTGTAGCTTGAGGG + Intergenic
1140243155 16:73222821-73222843 TCTCAATTGCTGTGGCTTTAAGG - Intergenic
1140260774 16:73377384-73377406 TCTTAATCACTGTGGCTTTATGG - Intergenic
1140384544 16:74523343-74523365 CCTTAATTACCGCTGCTTTACGG + Intronic
1141083058 16:81070397-81070419 CTTTGATTACTGTAGCTTTATGG - Intronic
1142015559 16:87744699-87744721 TTTTAATTACTGTAGCTTTATGG - Intronic
1143773734 17:9184429-9184451 CCTAAATTACTTCAGCTCTAGGG + Intronic
1143825588 17:9603909-9603931 TCTTGATTACTGTAGTTTTATGG - Intronic
1144113534 17:12063249-12063271 CCTTAATTACTGTAGCTTGCAGG - Intronic
1149508786 17:57219447-57219469 TCTTGATTACTGTAGCTTCATGG - Intergenic
1150516451 17:65815411-65815433 TCTTGATTACTATAGCTTTATGG + Intronic
1153106049 18:1528249-1528271 TTTCAATTACTGGCGCTTTAGGG + Intergenic
1153924327 18:9822063-9822085 TCTCGATTACTGTAGCTATATGG - Intronic
1154229653 18:12543572-12543594 CTTCTATTACTGGAGCCTTAGGG - Intronic
1155564327 18:27116483-27116505 TCTTAATTACTATGGCTTTATGG + Intronic
1157876912 18:51282293-51282315 CTTCAAATACTGTTGCTTTGGGG + Intergenic
1158781289 18:60654956-60654978 GCTTGATTAGTGTAGCTTTATGG - Intergenic
1160655783 19:268410-268432 TCTTCATTACTGTGGCTTTAGGG - Intergenic
1161863128 19:6813544-6813566 TCTTAATTACTGTAGATTTATGG + Intronic
1163226998 19:15969957-15969979 TCTTGATTACTGTAGCTTTATGG - Intergenic
1164766075 19:30771324-30771346 CTTTGATTACTGTAGCTTTGTGG + Intergenic
926398747 2:12472903-12472925 CCATGATTACTGTAGCTTTTTGG + Intergenic
926471896 2:13271035-13271057 CCTTAATTACTGTAGCTTTACGG + Intergenic
927612186 2:24552035-24552057 TCTTAATTGCTGTAGCTTTATGG + Intronic
929010529 2:37438539-37438561 TCTTAATTACTCTAACTTTATGG - Intergenic
930133395 2:47876430-47876452 CCTCACTTACAGAAGCTTGATGG - Intronic
932636974 2:73398367-73398389 TCTTTATTACTGTAGCTTTATGG + Intronic
934624831 2:95837336-95837358 TCTCCATTACTGTAGCTTTACGG - Intronic
934808740 2:97263991-97264013 TCTCCATTACTGTAGCTTTAGGG + Intronic
934828765 2:97493171-97493193 TCTCCATTACTGTAGCTTTAGGG - Intronic
935603967 2:104951111-104951133 CCTCCATTACTTTAGGTTTGGGG + Intergenic
936680994 2:114771114-114771136 CCTCAATTACTGATGCTTACAGG - Intronic
939596300 2:144127553-144127575 CCTCAATTTCTGATGCTTTGAGG - Intronic
940683178 2:156812048-156812070 CCTAAATTACTTTTGCTGTAGGG + Intergenic
940690510 2:156913857-156913879 CCTTGATTCCTGTAGCTTTATGG + Intergenic
940755088 2:157672926-157672948 CCTAAGTTATTCTAGCTTTATGG - Intergenic
941687334 2:168460606-168460628 TCTGAAATACTGTAGCTTTTTGG - Intronic
942153789 2:173106297-173106319 TCTTGACTACTGTAGCTTTATGG - Intronic
943217334 2:185055348-185055370 CCTTAATTTCTTTAGCTTTTTGG - Intergenic
943993803 2:194733579-194733601 GCTCTATTACTGGAGCTTCAGGG + Intergenic
944284791 2:197937170-197937192 TCTCAACTACTGTTGCTTTTAGG + Intronic
944780314 2:203010754-203010776 CCTTACTCTCTGTAGCTTTAGGG + Intronic
946681967 2:222226793-222226815 CCTAAATTACTGATGCTATAAGG + Intronic
947174996 2:227357062-227357084 ATTCAATTACTGTAGCTTTCTGG + Exonic
947233915 2:227920375-227920397 CCTCAATGACTGAAGGTTTGAGG - Intronic
1169983499 20:11414228-11414250 GTCCAATTACTGTAGTTTTATGG + Intergenic
1170355083 20:15483442-15483464 TCTTGATTACTGAAGCTTTATGG + Intronic
1171294013 20:24001235-24001257 CTTGTTTTACTGTAGCTTTATGG - Intergenic
1172449664 20:35013037-35013059 CCTCAAAAACTGTATCTTCAAGG + Exonic
1174126207 20:48308564-48308586 GCTCAATTTCTGCACCTTTATGG + Intergenic
1174769569 20:53285898-53285920 CCAGAATTACTGTAGCATCAGGG + Intronic
1177656785 21:24027310-24027332 CTTCAATTTATGTAGTTTTATGG - Intergenic
1182205868 22:28625794-28625816 CCTTAATTACTATAGATGTATGG - Intronic
949196066 3:1309511-1309533 CCTCAATTACTGTAGCTTTACGG + Intronic
953786948 3:45918106-45918128 CCTCAATTCATGTGGCCTTACGG - Exonic
954341129 3:49954645-49954667 TCTTGATTACTGTAGCTTTGTGG + Intronic
954584687 3:51722915-51722937 TCTTAATTACTGTAGCTTTATGG + Intergenic
954851850 3:53607914-53607936 TCTTGATTAATGTAGCTTTATGG + Intronic
954999270 3:54911884-54911906 CTACAATGTCTGTAGCTTTAAGG - Intronic
956832557 3:73066780-73066802 GCTAAATGACTGAAGCTTTAGGG + Exonic
958138071 3:89521974-89521996 CCTCATTTATTATAGTTTTAAGG - Intergenic
958649468 3:96919512-96919534 CTTCATTTAATTTAGCTTTAGGG + Intronic
958837398 3:99161518-99161540 CATTAATTACTGTAGCATTATGG - Intergenic
959429757 3:106238441-106238463 ACTCAATGAATGTGGCTTTATGG - Intergenic
959666558 3:108928826-108928848 TCTCAATTACTATACTTTTACGG + Intronic
959950581 3:112175796-112175818 CCTCAACCACTGTTGCCTTAGGG - Intronic
961423102 3:126822853-126822875 TATTAATTATTGTAGCTTTATGG + Intronic
961842716 3:129730543-129730565 TCTTGGTTACTGTAGCTTTATGG + Intronic
961974097 3:131004611-131004633 CTTCAACTACTGTAGCATTCTGG - Intronic
963477831 3:145829484-145829506 CCCAAATTACTGTTCCTTTATGG + Intergenic
965173199 3:165294875-165294897 CCTCAATTTCTATATCTATAAGG - Intergenic
967421812 3:189281741-189281763 CCTCAATGACTTTACCTTTCTGG + Intronic
967774115 3:193368539-193368561 TCTTAATTACTGTGGCTTTGTGG - Intronic
968859807 4:3158294-3158316 TCTTAATTATTGTAGCTTAATGG + Intronic
970149255 4:13071487-13071509 CCTCTATTACTCTAGGCTTATGG + Intergenic
970350824 4:15200443-15200465 TCTTGATAACTGTAGCTTTATGG + Intergenic
971893181 4:32553005-32553027 TCTTGATTACTGTTGCTTTATGG + Intergenic
972043981 4:34640039-34640061 CCTCAAGTTCTGTACCCTTAGGG - Intergenic
972420391 4:38881296-38881318 GCTCAATTTCTGTAGCATTCAGG - Intronic
972651964 4:41026611-41026633 TCTCATTTACTGTATCTTCAAGG + Intronic
974140017 4:57874210-57874232 TCTTGATTACCGTAGCTTTATGG - Intergenic
976111163 4:81675199-81675221 TCACAATTTGTGTAGCTTTAGGG + Intronic
976438181 4:85043320-85043342 TCCCAAGTACTGTATCTTTATGG - Intergenic
977155174 4:93562921-93562943 CCTAGATTGCTGTAGCTTTATGG + Intronic
977417610 4:96754228-96754250 CCTGAAGTCCTTTAGCTTTATGG - Intergenic
978020545 4:103805541-103805563 TCTTAATTACTGTAACTTTGTGG + Intergenic
978271078 4:106891917-106891939 CCTTGATTATTGTAGCTTTATGG - Intergenic
978298471 4:107237224-107237246 CTTTAATTTCAGTAGCTTTAGGG + Intronic
979425461 4:120559495-120559517 TCTGAATTACTGTAGCTTTATGG - Intergenic
981008116 4:139896567-139896589 CCTCATTTAGTGTGGCTTGATGG + Intronic
982815604 4:159879658-159879680 CAAAAATTATTGTAGCTTTAAGG + Intergenic
982838970 4:160158389-160158411 TCTTGATTACAGTAGCTTTATGG - Intergenic
983633603 4:169875696-169875718 TTAAAATTACTGTAGCTTTATGG + Intergenic
985251568 4:188029696-188029718 TCTTGATTACTGTATCTTTATGG + Intergenic
985477633 5:87983-88005 TTTTAATTACTGTAGCTTTGGGG + Intergenic
985507045 5:287746-287768 GCTAAATGACTGAAGCTTTAGGG - Intronic
985898875 5:2770544-2770566 TCTTAACTACTGTAACTTTACGG - Intergenic
989333474 5:40287574-40287596 CCTCAATTCCTGTGGCTATCTGG - Intergenic
990235936 5:53767320-53767342 CCTAAATTACTCTAACTTGAAGG + Intergenic
990314218 5:54568760-54568782 CCTCAACTACTTTTGCTTTTAGG + Intergenic
990547559 5:56837937-56837959 CCTCATTAACTGAAGCTCTAGGG - Intronic
991198812 5:63965696-63965718 CCCCAAATACTGTAGCAGTAGGG + Intergenic
992020241 5:72616146-72616168 TGTTAATTATTGTAGCTTTATGG - Intergenic
992332247 5:75729298-75729320 CTTCAATTACAGCAGCTTTGAGG - Intergenic
992832683 5:80610283-80610305 TCTCAATTATTCTAACTTTATGG - Intergenic
993265292 5:85719289-85719311 CTTAAATTACTGGATCTTTAGGG - Intergenic
993922072 5:93817575-93817597 ACTTGATTACTGTAGCTTTGTGG - Intronic
994892587 5:105656831-105656853 TCTAAATTATTGTAGTTTTATGG - Intergenic
995181225 5:109232206-109232228 TCTTGATTGCTGTAGCTTTAAGG - Intergenic
996139244 5:119885626-119885648 CCTCAAAGACTGTAGCCTAAAGG - Intergenic
997668125 5:135648610-135648632 CCTCAATTTCTCTAGCTTAAGGG + Intergenic
999215574 5:149932042-149932064 ATTCAATTACTGTAGCTTTCTGG - Intronic
999549819 5:152674369-152674391 CCTCAATTTTTGTAGGTTTATGG + Intergenic
999859495 5:155630712-155630734 TCTAAATTATTATAGCTTTATGG + Intergenic
1000061517 5:157660689-157660711 TCTTGATTACTCTAGCTTTATGG + Intronic
1000066903 5:157701120-157701142 TCTTGATTACTGTAGCTTTATGG + Intergenic
1000861366 5:166459803-166459825 CCTCAATTACAATAGATTTATGG + Intergenic
1000913820 5:167055429-167055451 TCTCAATTATTATAGCTTTATGG + Intergenic
1001345126 5:170888070-170888092 TCTTGATTACTGTAGCTTTATGG + Intronic
1002624485 5:180515689-180515711 CCTAACTTACAGTAGCTCTAAGG + Intronic
1003900643 6:10652162-10652184 TCTTGATTACTGTAGCTTTATGG + Intergenic
1003946697 6:11082730-11082752 CCTGGATTAGTGTAGCCTTAAGG - Intergenic
1007060545 6:38936562-38936584 CCAGAAGTACTGTACCTTTATGG + Intronic
1007868927 6:45009698-45009720 TCGTAATTACTGTAGCTTTATGG + Intronic
1009675714 6:66817483-66817505 TCTCCATTACTGTATTTTTAGGG + Intergenic
1009754121 6:67912901-67912923 CCTTAGCTACTGTAGCTTTATGG + Intergenic
1011887589 6:92116452-92116474 CCTCAATTAATGTATCCTTGTGG - Intergenic
1011913914 6:92477923-92477945 TCTTGATTACTGCAGCTTTATGG - Intergenic
1012028414 6:94027790-94027812 CCTCAAATACTTTATGTTTATGG + Intergenic
1012557262 6:100529296-100529318 TTTCAATTATTGTAGCTTTATGG + Intronic
1012950123 6:105509298-105509320 CTTCAATTACTGTAATTCTATGG + Intergenic
1013114684 6:107093520-107093542 TCTTGATTACTGTAGCTTTATGG - Intronic
1014772743 6:125475553-125475575 CCTCAATTACTGGGACTCTAAGG - Intergenic
1016064517 6:139665880-139665902 TCTTGATTATTGTAGCTTTATGG + Intergenic
1016179666 6:141129485-141129507 TCTTCATTACTGTTGCTTTAGGG - Intergenic
1016234863 6:141852499-141852521 TTTTGATTACTGTAGCTTTATGG - Intergenic
1016905036 6:149139953-149139975 CCTCTATTACTGCATATTTATGG + Intergenic
1017307756 6:152939173-152939195 GCTCAATGACTGAAGGTTTACGG + Intergenic
1020377303 7:7502484-7502506 GCTCACTTTCTGTTGCTTTAGGG - Intronic
1020394556 7:7699669-7699691 CCTCACTCAATATAGCTTTAGGG - Intronic
1020971806 7:14952822-14952844 TCTTAATTACTGTTGCTTTGTGG - Intronic
1022296355 7:29057912-29057934 TCTTAATTATTGTAGCTTTATGG + Intronic
1023425622 7:40032781-40032803 TATTAATTACTGTAGCTTTATGG + Intronic
1024467372 7:49726305-49726327 TCTTAATTATTGTAGCTTTATGG + Intergenic
1024713351 7:52043934-52043956 CCCCACTTACTGTAACTTCAGGG - Intergenic
1025243689 7:57299248-57299270 ACTTAATTATTGTAGCTTTTAGG + Intergenic
1026169060 7:67936995-67937017 ACTTAATTATTGTAGCTTTTAGG + Intergenic
1027900173 7:84103128-84103150 CCGCAATGACTGTAGCTTCTGGG - Intronic
1029876812 7:103762982-103763004 CTTCTATTTCTGTAACTTTATGG - Intronic
1030362210 7:108607034-108607056 CCCCAATTACTGTGCTTTTAAGG + Intergenic
1030708847 7:112725327-112725349 TTTTGATTACTGTAGCTTTATGG + Intergenic
1030790436 7:113720581-113720603 TCTTGATTACTGTAGCTTTATGG - Intergenic
1031248226 7:119345573-119345595 TTTCGATTACTGTAGCTTTGTGG + Intergenic
1031895428 7:127342196-127342218 TCTCAGTAACTGTAGCTCTAGGG - Intergenic
1032178581 7:129654847-129654869 TCTTGATTACTGTAGGTTTATGG + Intronic
1033544524 7:142388251-142388273 CATCAGGTACTGTAGCTCTAAGG + Intergenic
1035879511 8:3229820-3229842 TGTCAATTACTGTACCTTAAGGG + Intronic
1036921990 8:12865178-12865200 TCTCAATTACTGAAACTTTCAGG + Intergenic
1039011290 8:33096200-33096222 GCTGACTTACTGCAGCTTTAAGG - Intergenic
1041160886 8:55043029-55043051 TATCAATTACCATAGCTTTATGG - Intergenic
1041202044 8:55459025-55459047 TCTTGATTACTGTAGCTTTATGG - Intronic
1041373248 8:57186740-57186762 TCTTGATGACTGTAGCTTTATGG - Intergenic
1041821982 8:62046194-62046216 TCTTGATTACTGTAGATTTATGG + Intergenic
1042052536 8:64726864-64726886 CCCCAATTCCTGTAGCTCTTTGG + Intronic
1042774654 8:72416788-72416810 TCTTAATTACGATAGCTTTATGG + Intergenic
1043050566 8:75380287-75380309 ACTGAATTACTGCAGCTTTAGGG + Intergenic
1043541711 8:81270561-81270583 CCTAAATTCCTACAGCTTTAAGG - Intergenic
1043710860 8:83417072-83417094 TCTTGATTACTGCAGCTTTATGG + Intergenic
1044783554 8:95770178-95770200 CCTTGATTAGTGTAGCTTTATGG + Intergenic
1045130459 8:99146424-99146446 ACTTAATTACTGTAACTCTATGG + Intronic
1046825081 8:118680404-118680426 TCTTGATTACTGTAGTTTTATGG + Intergenic
1048624542 8:136170887-136170909 TCTTAATTACTGCAGCTATATGG + Intergenic
1053439151 9:38101373-38101395 TCTTAATTACTGTAGTTTTGTGG - Intergenic
1056427835 9:86495325-86495347 TCTTACTTACTGTAGCTTTATGG + Intergenic
1056741389 9:89258532-89258554 CCTTAATTACTGTAACTTTGTGG - Intergenic
1057790456 9:98121215-98121237 GCACAATTATTGTAGCGTTAAGG + Exonic
1059042873 9:110832952-110832974 TTTTGATTACTGTAGCTTTATGG - Intergenic
1186581168 X:10820283-10820305 GCTCACTGGCTGTAGCTTTATGG - Intronic
1188919927 X:35960239-35960261 CTGTAATTACTGCAGCTTTATGG + Intronic
1189884820 X:45531633-45531655 ACACAATTGGTGTAGCTTTATGG - Intergenic
1189934232 X:46050144-46050166 TCTTGGTTACTGTAGCTTTATGG - Intergenic
1191762224 X:64658021-64658043 CCTCAATTTCAGAACCTTTATGG + Intergenic
1192345977 X:70306241-70306263 TCTTCATTACTGTAGCTTTGTGG + Intronic
1192607416 X:72533247-72533269 TTTTGATTACTGTAGCTTTATGG + Intronic
1193102471 X:77630490-77630512 TTTTAATTACTGTAGCTTTGTGG - Intronic
1193664116 X:84295134-84295156 CCTCTTTTACTATATCTTTATGG + Intergenic
1196385859 X:115149644-115149666 TCTCAATTACTGAAACCTTATGG + Intronic
1197968335 X:132089097-132089119 TCTTAATTACTGTAGCTTTGAGG - Intronic
1198492517 X:137156483-137156505 TCTTGATTACTGTAGCATTATGG - Intergenic
1199743097 X:150754211-150754233 CATTGATTACTGTAGCTTTGTGG + Intronic
1199797643 X:151216450-151216472 CCTTGATCACTGTAGCTTTATGG + Intergenic
1199864838 X:151834455-151834477 CCTTGATTACTGTAGATTTATGG - Intergenic
1199865514 X:151845800-151845822 ACTTGATTACTGTAGCTTTATGG - Intergenic
1200342523 X:155413212-155413234 CCTTGATTACTGTTGCTTTGTGG - Intergenic
1200557493 Y:4654967-4654989 TCTTGATTACTGTAGCTTAATGG - Intergenic
1200968390 Y:9123113-9123135 TTTCACTTACCGTAGCTTTAAGG + Intergenic