ID: 949198237 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:1339224-1339246 |
| Sequence | ATTGAGGAGGGCATTGAGTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 256 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 17, 4: 236} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949198237_949198245 | 1 | Left | 949198237 | 3:1339224-1339246 | CCCCACTCAATGCCCTCCTCAAT | 0: 1 1: 0 2: 2 3: 17 4: 236 |
||
| Right | 949198245 | 3:1339248-1339270 | CCTCTCACCCTAAATCTCCATGG | 0: 1 1: 0 2: 2 3: 17 4: 185 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949198237 | Original CRISPR | ATTGAGGAGGGCATTGAGTG GGG (reversed) | Intronic | ||