ID: 949198237

View in Genome Browser
Species Human (GRCh38)
Location 3:1339224-1339246
Sequence ATTGAGGAGGGCATTGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949198237_949198245 1 Left 949198237 3:1339224-1339246 CCCCACTCAATGCCCTCCTCAAT 0: 1
1: 0
2: 2
3: 17
4: 236
Right 949198245 3:1339248-1339270 CCTCTCACCCTAAATCTCCATGG 0: 1
1: 0
2: 2
3: 17
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949198237 Original CRISPR ATTGAGGAGGGCATTGAGTG GGG (reversed) Intronic