ID: 949200130

View in Genome Browser
Species Human (GRCh38)
Location 3:1367333-1367355
Sequence CATAGTAAAGAGTAGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949200130_949200132 28 Left 949200130 3:1367333-1367355 CCACCATGCTACTCTTTACTATG 0: 1
1: 0
2: 3
3: 34
4: 248
Right 949200132 3:1367384-1367406 CTTAGCGTGACATCCAGAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949200130 Original CRISPR CATAGTAAAGAGTAGCATGG TGG (reversed) Intronic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
904646616 1:31972302-31972324 CATTTTAAAAATTAGCATGGTGG + Intergenic
905330890 1:37196204-37196226 AGAAGAAAAGAGTAGCATGGTGG + Intergenic
907651220 1:56296545-56296567 CAAAGTAAAGAGGAGCTTTGGGG - Intergenic
908171939 1:61513409-61513431 TAAAGTAGAGAGTAGAATGGTGG - Intergenic
908587696 1:65590465-65590487 AATAGTGAAGAACAGCATGGAGG - Intronic
909218098 1:72918011-72918033 CATAGTAGAGAGTAGAATGGTGG + Intergenic
910313615 1:85856977-85856999 GGAAGTAAAGAGAAGCATGGAGG + Intronic
910946807 1:92601662-92601684 AAAAGTACAGAGTAGAATGGTGG + Intronic
912852957 1:113142872-113142894 CATAAGAAAGAGTACCATAGAGG - Intergenic
913235890 1:116782833-116782855 AATAGAAAGGAGTAGCATGCGGG + Intergenic
914778703 1:150763248-150763270 AAAAGTAGAGAGTAGAATGGTGG + Intronic
916352731 1:163870263-163870285 AATAATATAGAGTAGAATGGTGG + Intergenic
916811525 1:168309618-168309640 CAGAGTTAAGTGTAGCATGGGGG + Intronic
917339297 1:173958012-173958034 CATAGTAAATAGTATCTTGTTGG - Intronic
918202535 1:182280503-182280525 CATGTGAAATAGTAGCATGGAGG + Intergenic
919340134 1:196294863-196294885 CATAGTAGAGAGTACAATGATGG + Intronic
919507000 1:198411610-198411632 CAAAGTAAGGAGTAAAATGGTGG - Intergenic
919556894 1:199067719-199067741 CATCGAAAAGAGTGGAATGGAGG - Intergenic
919663073 1:200266977-200266999 CTCAGTAGAGAGTAACATGGTGG + Intergenic
921260888 1:213384323-213384345 CATAGTAAAGAAAATCATGAAGG + Intergenic
921731032 1:218578178-218578200 CATAGTAATCAGTAGGCTGGGGG + Intergenic
921912885 1:220571486-220571508 CATATTAAATAGTACGATGGTGG - Intronic
922989494 1:229894354-229894376 CAAAATAAAGAGTACCCTGGGGG + Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
1063280297 10:4621372-4621394 TAGAGTATAGAGTAGAATGGTGG + Intergenic
1063301100 10:4849571-4849593 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1063947191 10:11189556-11189578 CACCGTAAAGAGTAGCAAAGAGG - Intronic
1065072287 10:22038252-22038274 CATACTAAAGAAAAGCAAGGAGG - Intergenic
1066463075 10:35629375-35629397 CATAATAATTAGCAGCATGGTGG + Intergenic
1066594322 10:37032590-37032612 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1067146997 10:43701322-43701344 CATGGTATAGAGTACCTTGGGGG + Intergenic
1068000489 10:51328159-51328181 AAAAGTAAAAAGTAGAATGGTGG - Intronic
1068122853 10:52801604-52801626 CATAATAAACAGTGGCCTGGGGG + Intergenic
1068984336 10:63093118-63093140 CTGAGTAGAGAGTAGAATGGTGG - Intergenic
1070209688 10:74303422-74303444 CATATTAAAGAATAGCCTGAAGG - Intronic
1072038951 10:91589827-91589849 CAGAGTAAGGAGTGGCCTGGTGG + Intergenic
1073489362 10:103842568-103842590 GGTAGTGAAGAGTAGAATGGCGG - Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1074192020 10:111146322-111146344 CATAGTAAAGATGGGCATGTGGG + Intergenic
1075909466 10:126111780-126111802 CATAATAAAGAGAAGCACTGGGG + Intronic
1078963862 11:16313663-16313685 CATAGTATAGAATAGCATAATGG - Intronic
1080674077 11:34408603-34408625 CAGAGTACAGATTAGAATGGAGG + Intergenic
1081058072 11:38435590-38435612 TATAGTAGAAAGTAGAATGGTGG - Intergenic
1082922179 11:58507664-58507686 CATAGGAACCAGTAGCAAGGAGG + Exonic
1084078376 11:66800190-66800212 CATAGTAGAGAATAGAATGGTGG + Intronic
1086186578 11:84024711-84024733 CAAAGCAGAGAGTAGAATGGTGG + Intronic
1086473589 11:87145134-87145156 CATAGCAGAAAGTAGAATGGTGG - Intronic
1086564340 11:88208402-88208424 TAGAGTAAAGAGTAGAATAGTGG - Intergenic
1090001444 11:122963322-122963344 GATAGTAAAGAGTTGCCTTGGGG - Intergenic
1092803365 12:12194885-12194907 AAAAGTAAAGAGTAGAATAGGGG - Intronic
1093734606 12:22606348-22606370 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1096379454 12:51143659-51143681 CATTTTAAAGAGAAGCATGGAGG + Intronic
1096435169 12:51583913-51583935 AAAAGTAAAGAGTAAAATGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097971990 12:65643174-65643196 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1101797986 12:107993871-107993893 AAAAGTAAAGAGTAGAATAGTGG - Intergenic
1102158609 12:110750607-110750629 CAGAGTATAGAGTAGCTGGGAGG + Intergenic
1103118857 12:118363551-118363573 CAAAGCAGAGAGTAGCAAGGAGG + Intronic
1106061173 13:26293951-26293973 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1106525318 13:30535470-30535492 AATGGTAAAGAGAAGCATGGAGG - Intronic
1107361825 13:39626417-39626439 CATAGTAGGAAGTAGAATGGTGG - Intergenic
1109364118 13:61333509-61333531 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1109418296 13:62073761-62073783 TAAAGTAGAGAGTAGAATGGCGG - Intergenic
1110984091 13:81941091-81941113 AAAAGTAAAGACTAGAATGGTGG - Intergenic
1111800816 13:92978329-92978351 CATAATTAAGGGCAGCATGGCGG + Intergenic
1113644522 13:111983325-111983347 CAAAGCAGAGAGTGGCATGGTGG + Intergenic
1114682731 14:24499958-24499980 CATAGAAATAAGTAGAATGGTGG - Intergenic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117853527 14:60002444-60002466 CATAGGAGAGAGTAGAATAGTGG - Intronic
1117927751 14:60802082-60802104 AGAAGTAAAGAGTAGAATGGTGG + Intronic
1118542713 14:66846768-66846790 CATAGTAAAGAGTAGAAAATGGG + Intronic
1118918222 14:70126265-70126287 AATAGTAAAGAGTAACTTAGGGG + Intronic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1120803837 14:88723407-88723429 CATAGCAGAGAGTAGATTGGTGG + Intronic
1122026838 14:98884241-98884263 CAGAGTGGAGAGTAACATGGTGG - Intergenic
1123045968 14:105514959-105514981 CCAAGAGAAGAGTAGCATGGGGG - Intergenic
1123508205 15:20967447-20967469 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123565425 15:21541194-21541216 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123601689 15:21978483-21978505 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1125499266 15:40228319-40228341 CAAAGCAAACACTAGCATGGTGG + Intergenic
1128420752 15:67489462-67489484 TATGGTGAAAAGTAGCATGGTGG - Intronic
1128434271 15:67630079-67630101 AAAAGTAAAAAGTAGCATGGTGG + Intronic
1129778357 15:78252019-78252041 CATAGCAGAGAGTAGAATGGTGG - Intergenic
1202973797 15_KI270727v1_random:268284-268306 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1134880282 16:17740148-17740170 CAGAGTAAGGATTTGCATGGAGG + Intergenic
1137033822 16:35551343-35551365 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1138041164 16:53668876-53668898 CATACTAAAAAGTAACATGAGGG + Intronic
1138292661 16:55861295-55861317 CATAGAAAAGAGGAGGATTGAGG - Intronic
1139591883 16:67937522-67937544 CAGGGTAAGGAGTAGCCTGGGGG - Intergenic
1142938915 17:3364520-3364542 TACAGTAGAGAGTAGAATGGTGG - Intergenic
1147947231 17:44086940-44086962 CACATCAAAGAGTAGCATTGAGG + Intronic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153066815 18:1055083-1055105 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
1155437964 18:25832839-25832861 CACAGTAGAGAGTAGAATAGTGG + Intergenic
1156123175 18:33870300-33870322 CATAGTAGAGAGTGGAATGGTGG + Intronic
1157228656 18:45892357-45892379 AATAGAACAAAGTAGCATGGTGG + Intronic
1158422511 18:57307954-57307976 CATGGTAGAAAATAGCATGGAGG + Intergenic
1158750967 18:60260363-60260385 CAAAGTAGAGAGTAGAATGATGG - Intergenic
1159264990 18:66069184-66069206 GATAGTCACCAGTAGCATGGAGG + Intergenic
1159667310 18:71177311-71177333 CATAGTAGAGAGTAGAATAGTGG - Intergenic
1159785526 18:72709645-72709667 CAGAGTAAAGCTTAGCATGTTGG + Intergenic
1162614547 19:11787044-11787066 GAGAGTAAAGAGTAGAATTGAGG - Intergenic
1166165291 19:40983630-40983652 AAAAGCAAAGAGTAGAATGGGGG + Intergenic
1167003183 19:46757677-46757699 AACAGTTAAGAGTAGCATGCAGG - Exonic
1167906287 19:52663678-52663700 CATAATAAAGACTAGAATGCAGG + Intronic
1168053883 19:53850152-53850174 AGAAGTAAAGAGTAGAATGGGGG + Intergenic
1168570229 19:57460913-57460935 AAAAGTAGAGAGTAGAATGGTGG - Intronic
925271503 2:2612700-2612722 CATAGAAGAGAGTAGAATGGTGG + Intergenic
927622858 2:24680530-24680552 CATAGGAGAGAGTAGAATGGTGG + Intronic
928750536 2:34466199-34466221 TAAGGAAAAGAGTAGCATGGTGG + Intergenic
928985527 2:37177505-37177527 CATAATAGAGAGTAGGATGGTGG + Intronic
929375393 2:41280948-41280970 CTCAGTAGAGAGTAGAATGGTGG + Intergenic
930166567 2:48209316-48209338 CACAGTACAGGGTAGCATGGAGG + Intergenic
932297163 2:70635589-70635611 CATAGAAGAGAGTAGAATGGTGG + Intronic
932694180 2:73940238-73940260 CAGAGTAAAGAATAGCCTGGAGG - Intronic
933086188 2:78057470-78057492 CATAGAAAAAAGAACCATGGAGG - Intergenic
935033957 2:99349972-99349994 AAAAGTAAAGAGTAGAATAGTGG - Intronic
936709267 2:115112673-115112695 GAAAGTAAAGAGTAAAATGGTGG + Intronic
939285911 2:140128999-140129021 CATAGTGAAGAGCAGTCTGGAGG - Intergenic
939714983 2:145572397-145572419 AATAGTAAAGAGTGGAGTGGGGG + Intergenic
939809682 2:146815320-146815342 CATAGTAGAGAATAGAATGGTGG - Intergenic
940274560 2:151925674-151925696 GATAGAAAAGAGGAGCAGGGAGG + Intronic
941388930 2:164887910-164887932 TAAAGTCAAGAGTAGAATGGTGG - Intergenic
941915119 2:170807086-170807108 CAAAGCAAAAAGTAGAATGGTGG - Intergenic
942855501 2:180541741-180541763 CAAAGTAATGAGTAGGGTGGGGG - Intergenic
945669205 2:212782228-212782250 CAAAGCAGAGAGTAGAATGGTGG - Intergenic
946906737 2:224424595-224424617 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
947251272 2:228107269-228107291 AAAAGTAGAGAGTAGAATGGTGG - Intronic
948335021 2:237200954-237200976 CATAGTAAAAGACAGCATGGTGG - Intergenic
948513941 2:238491139-238491161 CATAGTCATGAGTAGGAAGGAGG - Intergenic
1170326053 20:15155470-15155492 TCAAGTAAAGAGTAGCAGGGTGG - Intronic
1170671058 20:18434197-18434219 CATAGGAAATTGTAGCATGATGG + Intronic
1171287279 20:23951574-23951596 CATTGTAAAGAGTACAAGGGTGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1173331803 20:42081483-42081505 TATAGTAGAGAGTACTATGGAGG - Intronic
1173975046 20:47180607-47180629 CATAGTGAAATGTAGTATGGGGG - Intronic
1175009753 20:55723355-55723377 CAGAGAAAGGAGTCGCATGGTGG - Intergenic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176754283 21:10714267-10714289 AATGGAAAAGAGTAGAATGGAGG - Intergenic
1178414851 21:32395753-32395775 CGTAATAGATAGTAGCATGGTGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1185365888 22:50436563-50436585 CATAGTCAAGAGGAGCAGGCAGG - Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
950160789 3:10759148-10759170 CATAATAAAATGTTGCATGGGGG - Intergenic
951285436 3:20806782-20806804 CATTGTAAAGCGCACCATGGGGG + Intergenic
952267329 3:31799252-31799274 CACAGTTAAGAGTAGCGTGATGG + Intronic
952538345 3:34337891-34337913 CATATTGGAGAGTAGTATGGAGG + Intergenic
953124848 3:40081853-40081875 AATAGCAGAGAGTAGAATGGTGG - Intronic
954954274 3:54505457-54505479 CAAAGTAAAGAGTAGGGTAGAGG - Intronic
956234843 3:67058328-67058350 CATAGTGAAGATTAGCATGAGGG - Intergenic
956238388 3:67102159-67102181 AATAGTAAAGAAGAACATGGAGG + Intergenic
958575434 3:95944270-95944292 CATAGTAGAGAGTAGAATAGTGG - Intergenic
958735661 3:98006890-98006912 CATAGTAAAGAGTACTATATAGG + Intronic
958961613 3:100515803-100515825 GAAAGTAGAGAGTAGAATGGTGG + Intronic
960505126 3:118483804-118483826 CATAGCAAAGAGTGAAATGGAGG - Intergenic
960707712 3:120496329-120496351 CATAGGAAAGAGAAGCACTGAGG - Intergenic
964019607 3:151993293-151993315 TATGGTAAAGATTAGCATGCAGG - Intergenic
965402831 3:168233713-168233735 CAAAGTAAAGAGAGGCTTGGTGG - Intergenic
965408161 3:168296372-168296394 CATAGTAGAGAGGAGAATGATGG - Intergenic
967226915 3:187300935-187300957 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
967762756 3:193243136-193243158 TATAATAAAGAGTGGCATGAAGG - Intronic
967979207 3:195055412-195055434 CATTGTATAGAGTAGGCTGGAGG - Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972844998 4:42976997-42977019 AAAAGTAGAGAGTAGAATGGTGG - Intronic
973545249 4:51974326-51974348 TATAATAGAGAGTAGAATGGTGG - Intergenic
974078486 4:57189633-57189655 CATAGAAGAGAGTAGAAGGGGGG - Intergenic
974805366 4:66872850-66872872 ATTAGAAAAGAGTAACATGGAGG + Intergenic
975399683 4:73920109-73920131 CATGGGAAAGAGTAACATGCAGG + Intergenic
975524023 4:75329984-75330006 CATATTAAAGAATGGCATGTAGG + Intergenic
975931539 4:79529918-79529940 CCTAGCAAAGAGTAGTATGAAGG - Intergenic
976422560 4:84862888-84862910 CGAAGTAGAGAGTAGAATGGTGG - Intronic
977032165 4:91897874-91897896 CAGAGTAAAGGGTAGCATTAGGG + Intergenic
977760667 4:100732858-100732880 CATGGTAGGGAGAAGCATGGAGG + Intronic
977800207 4:101219410-101219432 AATATTAAAAACTAGCATGGAGG + Intronic
978210401 4:106129195-106129217 CATAGGAAAGAGGGCCATGGTGG + Intronic
979003211 4:115253937-115253959 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
979343428 4:119556343-119556365 CATTTTAAACAGTAGGATGGGGG - Intronic
979768238 4:124489540-124489562 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
980451403 4:132977305-132977327 CATAGTAGAGAGTATGATTGTGG + Intergenic
980496454 4:133591637-133591659 CATAGTATAGAATAGAACGGAGG - Intergenic
981877963 4:149571445-149571467 CACAGTAGAGAGTAAAATGGTGG + Intergenic
982064672 4:151643618-151643640 GGAAGTAAAGAGTAGAATGGTGG - Intronic
982656858 4:158160916-158160938 AAAAGTAGAGAGTAGAATGGTGG + Intronic
983968165 4:173839360-173839382 CATAGTAAAGACTTACTTGGTGG - Intergenic
986365420 5:7023735-7023757 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
988606507 5:32683167-32683189 CATAGTATATAGTAGCAAGATGG - Intergenic
988724038 5:33907884-33907906 AATAGTAGAGAGTACAATGGTGG + Intergenic
993259199 5:85637693-85637715 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
994872580 5:105371486-105371508 GCTAGTAAAGAGTAACATGAAGG + Intergenic
997058210 5:130469829-130469851 AGAAGCAAAGAGTAGCATGGTGG + Intergenic
999054295 5:148557232-148557254 GGTAGTTAAAAGTAGCATGGTGG + Intronic
999323956 5:150631613-150631635 CATAGGAAAGAGGAGCATGCTGG + Intronic
999513202 5:152274260-152274282 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
999625382 5:153515436-153515458 AGAAGTAAAGAGTAGAATGGTGG + Intronic
1000531577 5:162428490-162428512 GGAAGTAGAGAGTAGCATGGTGG - Intergenic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1002363274 5:178690472-178690494 CATAGAAGAGAGTAGAATGGTGG - Intergenic
1004893164 6:20121443-20121465 CAAAGAAAAGGGAAGCATGGGGG + Intronic
1006756337 6:36418888-36418910 CAGAGTAAAGAGTGGCAGGGGGG + Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1012041126 6:94205425-94205447 CAAAGGAAAGAGTAGAATTGGGG + Intergenic
1012733329 6:102909113-102909135 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1012946880 6:105475754-105475776 CACAGCAGAGAGTAGAATGGAGG - Intergenic
1012962932 6:105641768-105641790 CATAGCACACAGTAGCATGCTGG + Intergenic
1013051112 6:106536141-106536163 CATGCTAAATAGTAGCATGAGGG - Intronic
1013641826 6:112091041-112091063 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1014184027 6:118414974-118414996 CATGGGAGAGAGTAGAATGGTGG + Intergenic
1014215775 6:118751452-118751474 CATGGTAAAGACCAGCTTGGTGG + Intergenic
1015566965 6:134583302-134583324 CATAGTAAAGAGGAGCAGAAGGG - Intergenic
1015855912 6:137624243-137624265 AATGTTAATGAGTAGCATGGTGG + Intergenic
1017115351 6:150971061-150971083 CAAAGTAAAGAGTAGAATAGTGG + Intronic
1018511755 6:164532163-164532185 CTTAGTATAAAGTAGCGTGGTGG + Intergenic
1018816458 6:167336216-167336238 CACTGTAGAGAGCAGCATGGAGG - Intronic
1020707350 7:11561949-11561971 CATATTAAAGTGTAGCATAGTGG - Intronic
1020837617 7:13173668-13173690 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1021230131 7:18076318-18076340 CATAGCAAAGAGTAGAATGGTGG - Intergenic
1021602576 7:22378905-22378927 CCTGGTAGAGAGTAGGATGGAGG + Intergenic
1024310101 7:47961382-47961404 CATAGGAGATAGTAGAATGGTGG + Intronic
1024622281 7:51172157-51172179 CATCATAAGGAGTAGCCTGGTGG - Intronic
1027528131 7:79296687-79296709 CATAGTAGAGAGTAGAATGGTGG + Intronic
1027568520 7:79830581-79830603 AAAAGTAAAGAGTAGCACGGTGG + Intergenic
1027727956 7:81830916-81830938 GAAAGTAAAGAGTAGAGTGGTGG + Intergenic
1028109709 7:86925190-86925212 CATTTTAAAGAGTAGCATGATGG - Intronic
1028704595 7:93824903-93824925 CATAGTATAGTGAAACATGGGGG + Intronic
1030839126 7:114326629-114326651 CAAAGTAAAGATTAGCATATTGG + Intronic
1031436657 7:121740083-121740105 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1031555377 7:123168852-123168874 TATAGGAAAGAGTAACCTGGAGG + Intronic
1037603237 8:20416457-20416479 CATAGGAAATGGTATCATGGTGG + Intergenic
1039448410 8:37650816-37650838 GAAAATTAAGAGTAGCATGGAGG + Intergenic
1039651376 8:39342602-39342624 CAAAGTAGAGAGTAGAATGGTGG + Intergenic
1040716907 8:50266818-50266840 CAAAGTGAAGAGTAGCACTGTGG - Intronic
1040740686 8:50571109-50571131 CAAAGCAAAGAGGGGCATGGGGG - Intronic
1041008372 8:53517557-53517579 TATAGTGAAGACTGGCATGGTGG - Intergenic
1043656093 8:82668102-82668124 GAAAGTAGAGAGTAGCATTGTGG - Intergenic
1043822795 8:84889336-84889358 CATTGTAAATGGCAGCATGGAGG - Intronic
1043980803 8:86636771-86636793 AGTAGTAGAGAGTAGGATGGGGG - Intronic
1044145450 8:88708534-88708556 CACAGTAAAGCATAGCAAGGGGG - Intergenic
1044381292 8:91536976-91536998 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1046125767 8:109905306-109905328 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1046781336 8:118218555-118218577 CATAGCAGAGAGTAGAATGGTGG - Intronic
1051023905 9:12582371-12582393 CACAGAAAAGAATGGCATGGTGG - Intergenic
1051234827 9:14988596-14988618 AGAAGTAAAGAGTAGGATGGTGG + Intergenic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1051894319 9:21972035-21972057 AGCAGTAAAGAGTAGAATGGTGG - Intronic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052598880 9:30598905-30598927 ACAAGTAAAGAGTAGGATGGTGG - Intergenic
1053566410 9:39257342-39257364 AGGAGTAGAGAGTAGCATGGTGG - Intronic
1054130737 9:61361670-61361692 AGGAGTAGAGAGTAGCATGGTGG + Intergenic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055317812 9:75051612-75051634 CATAATACAGTATAGCATGGTGG + Intergenic
1055442350 9:76348827-76348849 AGAAGTAAAGAGTAGAATGGTGG - Intronic
1055613190 9:78044091-78044113 AACTGTAAAGAGTAGGATGGAGG + Intergenic
1058858621 9:109091767-109091789 TATAGTAAAATGTAACATGGTGG - Intronic
1059011443 9:110466191-110466213 CTTAGTATAGAGAAGCATGGTGG - Intronic
1059702410 9:116788120-116788142 CGTATTAGAGAGTAGAATGGTGG + Intronic
1060844336 9:126823679-126823701 AATAATAAAAAGTAGGATGGGGG - Intronic
1062142283 9:134966206-134966228 CACAGTAAAGAGAAGCCTGCAGG - Intergenic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1186605892 X:11090837-11090859 CACAGAAAAGAGTACCAGGGAGG - Intergenic
1186989356 X:15050546-15050568 CATAGTAAAGGGCAAAATGGTGG + Intergenic
1188049503 X:25467203-25467225 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1188165229 X:26854396-26854418 CATTGTAAAAAGTAGAATGTTGG - Intergenic
1189407433 X:40737330-40737352 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189561752 X:42198196-42198218 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1191767197 X:64710782-64710804 CCAAGCAAAGAGTAGAATGGTGG + Intergenic
1197072783 X:122320867-122320889 CATAGAAATGAGTAGAATGGTGG + Intergenic
1198628787 X:138610997-138611019 GATAGTAAAAAGGAACATGGAGG - Intergenic
1200445117 Y:3252459-3252481 TGTAGTAAAGAAAAGCATGGTGG - Intergenic
1201529770 Y:14979043-14979065 CAGGGTGAAGAGTATCATGGTGG - Intergenic