ID: 949201497

View in Genome Browser
Species Human (GRCh38)
Location 3:1385735-1385757
Sequence CTTACAACACTGCTGGGACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949201492_949201497 1 Left 949201492 3:1385711-1385733 CCATCTACTTTGCTTCCGTAAGA 0: 1
1: 0
2: 1
3: 8
4: 111
Right 949201497 3:1385735-1385757 CTTACAACACTGCTGGGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949201497 Original CRISPR CTTACAACACTGCTGGGACA GGG Exonic
903463188 1:23533613-23533635 CTCACAACACTGCTCTGAGACGG + Intergenic
903522804 1:23965552-23965574 CTAAAAACACTCCTGGGAAATGG - Intronic
904570225 1:31458742-31458764 CTTGCAACACTGCTGTGACCAGG + Intergenic
904753615 1:32755810-32755832 CTTTCAGGACTGCTGGGGCAGGG - Intronic
904883547 1:33718587-33718609 CTGACCACACTGCTGGTTCATGG - Intronic
906824173 1:48961152-48961174 CCTAGAACACTGCAGGAACATGG + Intronic
906899538 1:49818896-49818918 CTAGCAAAACTGCAGGGACAAGG + Intronic
907423542 1:54363834-54363856 CTTACAACTCTTCAGGAACAGGG + Intronic
915784037 1:158587678-158587700 CTTCTAACACTGCTGCAACAGGG - Intergenic
918436502 1:184519168-184519190 TTTATAACAATGCTGGGAAAAGG - Intronic
919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG + Intronic
920049470 1:203154620-203154642 CCTAGTACACAGCTGGGACAGGG + Intronic
922346213 1:224698946-224698968 CTTACCACACTGCTGTGATGTGG + Intronic
923394477 1:233547415-233547437 CTCACAACAGTGCAGGGAGAAGG - Intergenic
924626522 1:245700319-245700341 CTTACTACACTGCTTGGCCCAGG + Intronic
1063119281 10:3093247-3093269 CTTTCAACACTGTTGGGGGAAGG - Intronic
1064846381 10:19659313-19659335 CTTACAATAGTCCTGGGAGATGG + Intronic
1065869027 10:29940381-29940403 AATACAACAGTGCTGGGATATGG + Intergenic
1067051413 10:43023494-43023516 CCTAGAACAATGCTGGCACAGGG + Intergenic
1071354833 10:84784076-84784098 ATTCCAACACTGCTGGCACCTGG - Intergenic
1072746084 10:97940175-97940197 CTCACAACAATCCTAGGACATGG + Intronic
1072960863 10:99927822-99927844 ATTACAACACTGCAGAGAGAAGG + Intronic
1075521666 10:123147272-123147294 CTTAAAACACGGGTGGGCCATGG + Intergenic
1076573944 10:131451654-131451676 CTCACAGCACTGCTGGGGGAGGG + Intergenic
1078352517 11:10606229-10606251 CTCACAACCCCGCTGGGACAAGG + Intronic
1078367100 11:10715772-10715794 CTTCCAACTCTGCCGGGAAATGG + Intergenic
1084612606 11:70212999-70213021 CTTACAACATTGCTGGGAGAGGG - Intergenic
1085170609 11:74446658-74446680 CTCACAAGTCAGCTGGGACAGGG + Intergenic
1085225083 11:74912441-74912463 CTGACAACCCTGCTGGGCCAGGG + Intronic
1085530483 11:77189514-77189536 CTCCCCACAGTGCTGGGACAGGG - Intronic
1085624656 11:78062699-78062721 CTTCCAAGACTGCTGGTCCAAGG + Intronic
1086281684 11:85196623-85196645 CTTAGCACACTGCTGGGACCAGG + Intronic
1087019923 11:93591763-93591785 CTGACAAGACTGCAGAGACAAGG + Intergenic
1087111256 11:94470863-94470885 CTTACAAGACTGATCAGACAGGG - Intronic
1091556673 12:1578984-1579006 CTTACAACATTTTTGGGACAAGG + Intronic
1092020718 12:5200212-5200234 CTTACAACTCTTCTGTGACAGGG - Intergenic
1105559947 13:21480875-21480897 CCTCCAACAGTGCAGGGACATGG + Intergenic
1107536885 13:41343970-41343992 CTTATGAAACTGCTGGGGCAGGG - Intronic
1114672255 14:24417506-24417528 CTGAGAGCACTGCTGGGACAGGG - Exonic
1115157228 14:30355137-30355159 CTTAAAACAATGCTTGGTCATGG - Intergenic
1117006338 14:51424995-51425017 CATACAAAACAGCTGAGACAGGG + Intergenic
1119196119 14:72717887-72717909 ATTCCCACACTGCTGGGCCATGG + Intronic
1120195096 14:81472569-81472591 CTTAAAAAATTCCTGGGACAAGG + Exonic
1121308165 14:92920435-92920457 CAGACATCACTGCTGGGAAATGG + Intergenic
1122714928 14:103690480-103690502 CTCACAGCACTGCTGACACACGG + Intergenic
1124511120 15:30326789-30326811 AATACAACAGTGTTGGGACATGG + Intergenic
1124731794 15:32203976-32203998 AATACAACAGTGTTGGGACATGG - Intergenic
1125126583 15:36230452-36230474 CTTGGAACTCTGCTGGTACAAGG + Intergenic
1126335644 15:47583749-47583771 CTTACAAGTCTTCTGGGAAAGGG + Intronic
1127845271 15:62865350-62865372 CCTACAACACTGCTATGTCATGG - Intergenic
1129158924 15:73736223-73736245 CTTTCAACACTGCTGAGTCATGG - Exonic
1130949763 15:88576189-88576211 CTTAGAACACTGCTGGCATATGG - Intergenic
1138925183 16:61581744-61581766 CTTTCGACCCTGCAGGGACAGGG + Intergenic
1139548899 16:67662670-67662692 CACTCCACACTGCTGGGACATGG + Exonic
1140725138 16:77805060-77805082 CTTCCCACACTGCTGGCTCATGG - Intronic
1141779949 16:86152734-86152756 CCTAGAACAGTGCTTGGACATGG - Intergenic
1142107089 16:88309978-88310000 TTTACAACACGGGTGGGTCATGG - Intergenic
1143291752 17:5836627-5836649 CTTAGGACACTGTTGGCACATGG - Intronic
1146482159 17:33213477-33213499 CTTGCAACAATGATGAGACAAGG + Intronic
1148713380 17:49698168-49698190 CTTAGAACACTCCTGGGAAGAGG - Intergenic
1149141334 17:53436365-53436387 CCTACAGCACTGGTGGGAGAAGG - Intergenic
1149783980 17:59420378-59420400 CCTAGAACAGTGCTGGCACAAGG + Intergenic
1151499739 17:74481207-74481229 CTTACAAGCCTTCTGGGAAAAGG - Intronic
1151952409 17:77362416-77362438 CTTGCAGGACTGCTGGGGCAAGG + Intronic
1153428060 18:4987945-4987967 CTTCCAACCCTGCAGGGTCAGGG + Intergenic
1154346683 18:13548618-13548640 CTTCCAAGCCTGCTGGGGCACGG + Intronic
1156399088 18:36724700-36724722 CTAAGAACACTGCAGGGAGAGGG - Intronic
1157388717 18:47282813-47282835 TTTACAGCACAGCTGGGAAAAGG - Intergenic
1157430071 18:47617345-47617367 AGTGCAACAGTGCTGGGACATGG + Intergenic
1157866712 18:51194188-51194210 ATTACTATGCTGCTGGGACATGG + Intronic
1157872388 18:51242469-51242491 TTTACAACATTGCTGGGGAATGG - Intergenic
1158608353 18:58916059-58916081 CTTTCAACCCTGGTGGGGCAGGG + Intronic
1158742878 18:60164185-60164207 CATACTACACTGCTGGGATAGGG + Intergenic
1159038380 18:63299071-63299093 CTTACAACAGTACTGGGAGGTGG - Intronic
1164402337 19:27910810-27910832 GATACAACACTGCTGGGGCCGGG + Intergenic
1165093983 19:33400782-33400804 CTCCCATCACTGCTGGGAAATGG + Intronic
1167506452 19:49873412-49873434 CACACAGCACCGCTGGGACAAGG - Intronic
937164318 2:119796759-119796781 GTTACAACAATGCTGGAAAACGG - Intronic
938450780 2:131417767-131417789 CTTCCAACACTGCTGGCAGCTGG - Intergenic
938683363 2:133714109-133714131 CTTACAACAGTGATTGGCCAGGG + Intergenic
940554416 2:155205371-155205393 CTTTCAACACTGCAGGGAGAGGG - Intergenic
942348782 2:175031111-175031133 ATTGCCACACTGCTGGGAAATGG + Intergenic
946034927 2:216734217-216734239 CTTACTACACTGATTGGAAATGG - Intergenic
947541601 2:230983715-230983737 CTTACAGCTCTGATGGGCCAAGG + Intergenic
947748475 2:232521307-232521329 CCGACAGAACTGCTGGGACAGGG - Exonic
1170830631 20:19837056-19837078 CATACAACACTGCTGTAAGATGG + Intergenic
1171567943 20:26212113-26212135 CTTACATCACTGTTGGCACATGG - Intergenic
1173705336 20:45106197-45106219 CTCACAGAACTGCTGGAACAGGG + Intergenic
1174445345 20:50587380-50587402 CTTCCAACTCTCCTGGGCCAGGG + Intronic
1175390721 20:58625693-58625715 TTTCTATCACTGCTGGGACACGG + Intergenic
1180008035 21:45032403-45032425 CACACAAAACTGCTGGGAAACGG + Intergenic
1180091248 21:45534780-45534802 CTTACAAGGCTGCTGGGGGAGGG + Intronic
1181311709 22:21948488-21948510 CTTACAGCTCTGCTGGGGCATGG - Intronic
1183619506 22:38964465-38964487 CTCATGACACTGCTGGGACCTGG + Intronic
1184242499 22:43218577-43218599 CTCACAACAGTCCTGGGGCAAGG + Intronic
1184784448 22:46664929-46664951 CTTACCACTCACCTGGGACATGG + Intronic
1185003416 22:48260885-48260907 CTCACAACACTGCCGTGAGATGG - Intergenic
949201497 3:1385735-1385757 CTTACAACACTGCTGGGACAGGG + Exonic
949439517 3:4065766-4065788 CTTTAAACTCTGCTGGGACCAGG - Intronic
950725474 3:14914273-14914295 CTAACAACACTGCTGGGCGTGGG - Intronic
950958045 3:17076124-17076146 CTTGCAACACTGCTGGGGAAAGG - Intronic
950994378 3:17479985-17480007 CTTTCAAAGCTGCAGGGACAAGG - Intronic
952796885 3:37247215-37247237 CTTACAACAGTGCTGTGATGAGG + Intronic
953518078 3:43616635-43616657 CTTTGAACACTGCAGTGACACGG + Intronic
954764575 3:52902639-52902661 CTCACAAAGCTGCTGGGACTGGG - Intergenic
954875863 3:53802864-53802886 CTTACCACATTCCTGGGGCAGGG + Intronic
956617858 3:71190742-71190764 CTTGCAACAAAGCTGAGACAAGG + Intronic
957278882 3:78124732-78124754 CTTACACTATTGATGGGACATGG + Intergenic
959386329 3:105713155-105713177 ATTAGAACAGTGCTGGCACATGG - Intronic
960104565 3:113780541-113780563 CTTAAAACTCTTCTGGGACATGG - Intronic
962169499 3:133086101-133086123 CTTTCACCACTCCTTGGACAAGG - Intronic
963063220 3:141241682-141241704 CGTCCAACACTGCTGTGCCATGG + Intronic
964328735 3:155576421-155576443 CTTAAAACACGGCTGTGCCAAGG - Intronic
969407069 4:7000577-7000599 CCTTCAGCTCTGCTGGGACACGG - Intronic
970385170 4:15548788-15548810 TTCACAACTCTGATGGGACAAGG - Intronic
982241711 4:153306303-153306325 CTTACAACAGTGCAGGCACATGG + Intronic
982609587 4:157557180-157557202 CTTAGAAAACTGCTGGGAAGGGG - Intergenic
986190126 5:5488915-5488937 CTCAGAACACTGCTGGGGCCAGG + Intronic
986777574 5:11031845-11031867 CTTACACCACTGGTTTGACAGGG + Intronic
987133389 5:14879820-14879842 CTAACAACATTCCTGGCACATGG - Intergenic
987999905 5:25334750-25334772 CTTACAACAGTGGTGTGCCAGGG + Intergenic
989544211 5:42653929-42653951 CTTACAACACTGGGGAGAAAAGG - Intronic
990957806 5:61361164-61361186 CTTAGCACAGTGCTGGCACATGG - Intronic
992177482 5:74164698-74164720 CCTAGGACACTGCTGGGAAAAGG - Intergenic
995687225 5:114784020-114784042 CTTAGAACAGTGCTGGTTCAGGG + Intergenic
996786423 5:127241562-127241584 GTTATAAGACTGCTGGGAGAGGG + Intergenic
1001052658 5:168425454-168425476 CTTACAACACCTCTGGGAAGTGG + Intronic
1004138278 6:12990119-12990141 CTTAGAAAACTGTTGGGAAAAGG - Intronic
1006072498 6:31507620-31507642 GTGACAAGGCTGCTGGGACAGGG + Intronic
1006167412 6:32073297-32073319 TTTACAACCCTGCTGTGACTTGG - Intronic
1007164975 6:39822818-39822840 CTCAGGACACAGCTGGGACAGGG + Intronic
1011544822 6:88471678-88471700 ATTAGAATCCTGCTGGGACAAGG + Intergenic
1011968728 6:93194717-93194739 TTTACAACAGTGCTGGCACTTGG + Intergenic
1017050923 6:150392569-150392591 CTTACAACAAAGCCAGGACATGG - Intronic
1019851033 7:3557632-3557654 CTTAGTACAATGCTGGGACCAGG - Intronic
1022195920 7:28067252-28067274 CTCACAACACTGATGGAGCAAGG - Intronic
1023078636 7:36507208-36507230 CTCACAACAGTGCTGGAAAATGG + Intergenic
1023172140 7:37399858-37399880 CTCACAACAATCCTGGGAGAAGG - Intronic
1023483862 7:40663780-40663802 ATGCCAACACTGCTGGGCCATGG - Intronic
1023908480 7:44538219-44538241 CCAACAACGCTGCTGGGCCAAGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026392121 7:69912257-69912279 CTTCCAAGACTGCTCGGGCAGGG + Intronic
1028893480 7:96014348-96014370 CTTACATGTCTGCTGGGAGAAGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1033573855 7:142660731-142660753 CTTACAAGGCTGCTGAGAAAAGG - Intergenic
1034423618 7:151001691-151001713 CCCAGAACACTGCTGGGGCAGGG - Intronic
1040025205 8:42775424-42775446 CTCACCACACTCCTGGGACATGG - Intronic
1041272757 8:56124873-56124895 CTTACATCACTCCTGGGAAGGGG + Intergenic
1041734802 8:61098606-61098628 CTTGCAACACTCCTGGGAGGTGG + Intronic
1042203069 8:66300609-66300631 CATCGATCACTGCTGGGACATGG + Intergenic
1045083981 8:98660673-98660695 CCTACAACATTGGTGGGAGAGGG - Intronic
1045976829 8:108138773-108138795 CTTAGAACATTGCTGGTTCATGG - Intergenic
1048207368 8:132426150-132426172 CTTACACCACAACTGGGATAGGG - Intronic
1049328871 8:142039121-142039143 CCATCAACACTGCAGGGACAAGG + Intergenic
1056762587 9:89425725-89425747 TTTACAGCACTGCTGGGAAGAGG + Intronic
1057715161 9:97487899-97487921 CTTAAAACATTCCTGGGTCATGG + Intronic
1058096193 9:100862848-100862870 CTTACAACAGTGGTGTGCCAGGG + Intergenic
1061382018 9:130264500-130264522 CTGACGACTCTGCAGGGACAGGG + Intergenic
1188444146 X:30239295-30239317 CTTATATCACTCCTGGGACAGGG + Intergenic
1188444873 X:30245954-30245976 ATCACATCACTTCTGGGACAGGG + Intronic
1190057885 X:47192545-47192567 CTTAGAACATTGCTGGCACAAGG - Intronic
1191825572 X:65362051-65362073 GTTCCCACACTGATGGGACATGG - Intergenic
1192093780 X:68188176-68188198 CTTACAAGAATGCTAGGAAATGG + Intronic