ID: 949201617

View in Genome Browser
Species Human (GRCh38)
Location 3:1387272-1387294
Sequence CAGCCCAGCCTGTCTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949201617_949201618 -3 Left 949201617 3:1387272-1387294 CCAGTTTTAGACAGGCTGGGCTG 0: 1
1: 0
2: 1
3: 18
4: 219
Right 949201618 3:1387292-1387314 CTGTGAGTTATTTTCAAGAATGG 0: 1
1: 0
2: 3
3: 43
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949201617 Original CRISPR CAGCCCAGCCTGTCTAAAAC TGG (reversed) Intronic
900755465 1:4431372-4431394 CAGCCCCTCGTGTCTAAAACAGG - Intergenic
900899208 1:5505437-5505459 CAGCCCACCCTGACTAACATGGG + Intergenic
901019548 1:6248934-6248956 CAGCTCAGCCTCTCCAAAGCGGG + Exonic
901670954 1:10856206-10856228 CCGCCCAGGCTGTCTTAAAGGGG - Intergenic
905023292 1:34832836-34832858 GAGCCCAGCCTGGCTCATACAGG + Intronic
907247942 1:53120101-53120123 AGGCCCAGCCTGTCTCAATCTGG + Intronic
907359345 1:53902245-53902267 CTGCCCCGCCTGTCTAAAATAGG + Intronic
908252340 1:62274831-62274853 CAGCCCCGCCCCTCCAAAACTGG - Exonic
908348560 1:63261389-63261411 CAGCCCAGTCTTTATTAAACTGG - Intergenic
908382237 1:63607588-63607610 CAGACCAGGCTGTCAAAAAAAGG + Intronic
909637104 1:77828874-77828896 GAGCCCAGCCTGTGAAATACAGG - Intronic
910718549 1:90258901-90258923 CACCCCAGGCTATTTAAAACAGG - Intergenic
912449324 1:109759636-109759658 CAGCCCAGGCTGGCTATCACTGG + Intronic
915060522 1:153179201-153179223 CAGACCAGCCTGTATAAACTAGG + Intergenic
916799707 1:168204918-168204940 GAGACCAGCCTGTCTAACATGGG + Intergenic
917035253 1:170741649-170741671 CAGCCCAACTTGACAAAAACAGG - Intergenic
917110780 1:171545302-171545324 CAGCACAACCTTACTAAAACCGG - Intronic
917537801 1:175887258-175887280 GAGACCAGCCTGACTAACACAGG - Intergenic
921655772 1:217735181-217735203 CAGCCCAAACTGACTAAGACCGG - Intronic
922251207 1:223850214-223850236 CTGGCCAGCCTATCTAAAACAGG - Intergenic
923197750 1:231684694-231684716 CAGCCCAGAATCACTAAAACTGG - Intronic
1063377261 10:5561767-5561789 CAGCTCAGCCTTTCTGAGACTGG - Intergenic
1064640847 10:17414493-17414515 CAGCCCAAGCTGACTAAGACAGG - Intronic
1064939993 10:20723447-20723469 CAGCCCAAGCTGACTAAGACAGG + Intergenic
1068208388 10:53887685-53887707 CAGACCATCCTGACTAACACGGG + Intronic
1069174140 10:65269415-65269437 CAGACCATCCTGGCTAACACGGG - Intergenic
1069573622 10:69509124-69509146 CAGACCAGCCTGTCTCCTACGGG - Intergenic
1069884931 10:71617791-71617813 GAGACCAGCCTGTCCAACACTGG + Intronic
1071127668 10:82354066-82354088 CACCCCAGCCTGTTTGAGACAGG - Intronic
1071310129 10:84335441-84335463 CAGCCCAGCCTGGGTAACATGGG - Intronic
1071355255 10:84787160-84787182 CAGTGCAGCCAGTCTAAAAGGGG - Intergenic
1073806875 10:107107952-107107974 CAGCTAAGAGTGTCTAAAACTGG - Intronic
1073830244 10:107375622-107375644 AAGCCCACCCTTTCTCAAACTGG + Intergenic
1074460832 10:113635625-113635647 CAGACCAGCCTGGCCAACACGGG - Intronic
1075003514 10:118814677-118814699 CAGCCCAAACAGACTAAAACAGG - Intergenic
1075638588 10:124048355-124048377 CTGACCAGCCTTTCTCAAACTGG - Intronic
1075834078 10:125438215-125438237 CAGGCCACCCAGTTTAAAACAGG - Intergenic
1076737748 10:132466284-132466306 CAGCCCAGCCTGCCCCAGACAGG + Intergenic
1077080478 11:722628-722650 CAGCCCTGCCTCTCCAGAACTGG - Intronic
1077288426 11:1777840-1777862 CAACCCAGCCTGTCTGAACTGGG - Intergenic
1081692582 11:45088307-45088329 CACCCCACCCTGTCTAAGCCTGG + Intergenic
1083935921 11:65870107-65870129 CAGCCCAGCCTCACCAACACAGG + Exonic
1085013708 11:73158733-73158755 CAGCCCAGGATTTCTCAAACTGG + Intergenic
1085335165 11:75687945-75687967 CTGCCCAGCCTCCCTAACACTGG + Intergenic
1089480557 11:118801358-118801380 GAGACCATCCTGTCTAACACGGG - Intergenic
1094631878 12:32183814-32183836 CAGCCCATCCTGTGGAACACAGG + Intronic
1095340151 12:41080547-41080569 CATCCCAGCATGGCTAAAAAGGG + Intergenic
1097182077 12:57177430-57177452 CATCCCAGTCTGTCCAAAACAGG - Exonic
1099485074 12:83219396-83219418 CATCCCATCATGTCTAAAATAGG - Intergenic
1101185381 12:102270939-102270961 GAGCCCATCCTGGCTAACACGGG + Intergenic
1102546904 12:113663964-113663986 CAACCCAGGCAGTCTGAAACGGG + Intergenic
1103616044 12:122153030-122153052 CAGCCCAGCCTGCCTTAAAAGGG - Intergenic
1105812252 13:24006020-24006042 CAGCCCAGCCAGTCTGACCCTGG - Intronic
1105968063 13:25402781-25402803 CAGCCCAACCAGACTAAGACAGG - Intronic
1107622184 13:42244701-42244723 GAGACCATCCTGGCTAAAACGGG + Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1110624056 13:77631816-77631838 CAGCCCATGCTGACTAATACTGG - Intronic
1111999064 13:95193330-95193352 CAGCTCAGGCTGCTTAAAACAGG - Intronic
1112042753 13:95564087-95564109 CATCCCAGCCTATCTAGGACTGG - Intronic
1112157591 13:96834439-96834461 CAGGCCAGAGTGTCTCAAACTGG + Exonic
1112639556 13:101257122-101257144 CAGCCCAGCCTCTGAAAAATAGG - Intronic
1113106014 13:106772247-106772269 CAGCACAGGCTTTCTACAACAGG - Intergenic
1117317062 14:54581469-54581491 CAGTCCAGCCTGTGGAAATCAGG - Intronic
1117387334 14:55229128-55229150 CACCCCAGCCTGGGTAACACAGG + Intergenic
1120036225 14:79701626-79701648 CAGCCCAGGCTATATAAAACTGG - Intronic
1121350159 14:93167070-93167092 GAGACCAGCCTGTCCAACACAGG - Intergenic
1121350367 14:93168497-93168519 GAGACCAGCCTGTCCAACACAGG + Intergenic
1123739542 15:23223195-23223217 CAGACCATCCTGGCTAACACGGG - Intergenic
1124290763 15:28452167-28452189 CAGACCATCCTGGCTAACACGGG - Intergenic
1124292473 15:28465391-28465413 CAGACCATCCTGGCTAACACGGG + Intergenic
1125343389 15:38696220-38696242 CAGCCCAGTCTGACAAACACAGG - Intergenic
1126001585 15:44215854-44215876 CAGAATAGCCCGTCTAAAACAGG + Intergenic
1128754088 15:70169762-70169784 CAGACCAGCCTGGATAACACAGG - Intergenic
1130944079 15:88537869-88537891 CTGACCATCCTATCTAAAACAGG + Intronic
1131995632 15:98130287-98130309 CAGTTCAGCCTGAATAAAACAGG + Intergenic
1133828598 16:9301320-9301342 AAGCCCAGCATGTCAACAACGGG - Intergenic
1137983117 16:53086359-53086381 CAGCCCAGTCTGTGTATAATTGG - Intronic
1140452255 16:75080309-75080331 CAGCCCAGCCTTTCTGTCACTGG - Intronic
1143192912 17:5053539-5053561 CAGACCAGCCTGACCAAAAATGG - Intergenic
1144085953 17:11808589-11808611 CAGCCCAGCCTCTCGACGACTGG + Intronic
1144120599 17:12149222-12149244 GAGACCATCCTGGCTAAAACGGG + Intergenic
1145051510 17:19665591-19665613 CTGCCCATCCTCTCTAGAACAGG - Intronic
1145106829 17:20124729-20124751 GAGCCCAGCCTGCTTTAAACAGG + Intronic
1145414885 17:22706784-22706806 CAGACCATCCTGGCTAACACGGG + Intergenic
1146337565 17:31988102-31988124 GAGCACAGGCTGTCTAAAAGAGG - Intronic
1149330080 17:55571488-55571510 CAGACCATCCTGGCTAACACGGG + Intergenic
1149658697 17:58323607-58323629 CAGCCCAGCCTGCCCAGAGCAGG + Intronic
1149779064 17:59381963-59381985 CAGCCCAGCCTGGCACAACCTGG - Intronic
1151750300 17:76033351-76033373 CAGCCCAGCCAGTCTTACTCAGG + Intergenic
1151797782 17:76357964-76357986 CAGCCCAGACAGACTAAAGCAGG + Intronic
1154957918 18:21277228-21277250 CAGCCCAGCCTTTTGAATACAGG + Intronic
1157554013 18:48600875-48600897 CAGTGCAGCCTGTCTCATACTGG + Intronic
1157564143 18:48668405-48668427 CAGGCCAGCCTGTCTGCACCAGG + Intronic
1157708130 18:49826491-49826513 CATCCCAGCGTGTCTCAATCTGG - Exonic
1157966169 18:52210843-52210865 CAGCCCAAACTGACTAAGACAGG + Intergenic
1159677059 18:71298136-71298158 CAGACCAGCCTGTGCAACACAGG - Intergenic
1162634849 19:11959584-11959606 CAGAGCAGCATGTCTACAACAGG - Intronic
1162884499 19:13686262-13686284 CAGACCAGCCTGGCCAACACGGG + Intergenic
1165321448 19:35087875-35087897 AAGACCAGCCTGTCTCAAGCAGG + Intergenic
1168159199 19:54497804-54497826 CAGCCCATCCTGGGTAAAATCGG + Intergenic
926138633 2:10355248-10355270 GAGACCATCCTGGCTAAAACGGG + Intronic
926551683 2:14309224-14309246 CAGCTCAGCCCGTCTAAACTAGG + Intergenic
926627774 2:15107429-15107451 CAGCCCAAGCTGACTAAGACAGG + Intergenic
931349811 2:61477013-61477035 GAGACCAGCCTGTCTAAACATGG + Intergenic
932576655 2:72965964-72965986 GAGCCCAGGCTGTCTCAGACAGG - Intronic
932883121 2:75522831-75522853 CAGGCCAGCCTCTCTGGAACAGG + Intronic
937941797 2:127291911-127291933 CAGCCCAAGCTGACTAACACAGG - Intronic
938307515 2:130265578-130265600 CAGCCCAGCCTGTCAAGAATGGG - Intergenic
938447817 2:131391264-131391286 CAGCCCAGCCTGTCAAGAATGGG + Intergenic
939208437 2:139139736-139139758 AAGCCCAGCCTGGCCAAAACAGG + Intergenic
942420505 2:175802165-175802187 CAGCTCACCCTTTCTAAACCAGG + Intergenic
942621851 2:177852497-177852519 CAGCTCAGCCTGTCTATCCCTGG + Intronic
944166573 2:196728255-196728277 AATCACAGCCTTTCTAAAACTGG - Intronic
944811537 2:203331556-203331578 CAGACCAGCCTGGCCAAAATGGG - Intronic
945199851 2:207270635-207270657 CAGCCCAAGCTGACTAAGACAGG + Intergenic
945287152 2:208094284-208094306 AAGACCATCCTGGCTAAAACGGG - Intergenic
945825551 2:214716710-214716732 CATTCCTGCCTGGCTAAAACAGG + Intergenic
946858712 2:223979124-223979146 CAGCCCAGGCGGACTAAGACAGG + Intronic
947352843 2:229264423-229264445 CACCCAGGCCTCTCTAAAACAGG + Intronic
1173001428 20:39108657-39108679 CAGTCCAGCCTGGCCAAAACTGG - Intergenic
1174580985 20:51571449-51571471 CAGACCACCCTGACTAAAAAAGG - Intergenic
1178798152 21:35764921-35764943 AAGACCAGCCTGTATAACACAGG + Intronic
1178969732 21:37162723-37162745 CAGCCCAAACTGACTAAGACAGG - Intronic
1179148398 21:38789266-38789288 CATCCCAGGCTGCCTAGAACTGG + Intergenic
1180833994 22:18920691-18920713 CAGGCCAGCCTGTATACAGCGGG - Intronic
1182109054 22:27710102-27710124 CAGCCCAGGCTGACTGATACAGG + Intergenic
1184496688 22:44846336-44846358 AGGCCCCGCCTGTCTAAAGCAGG - Intronic
1184543242 22:45144603-45144625 CAGTCCAGTCTGACTGAAACAGG + Intergenic
1203284080 22_KI270734v1_random:145989-146011 CAGGCCAGCCTGTATACAGCGGG - Intergenic
949201617 3:1387272-1387294 CAGCCCAGCCTGTCTAAAACTGG - Intronic
949810454 3:8001327-8001349 CAGACCACCCTGTTTAAAATAGG + Intergenic
950125615 3:10508014-10508036 GAGCCCAGCCCGTCTCAGACAGG - Intronic
950190448 3:10972896-10972918 CAGCCGAGCCTGACTGCAACAGG + Intergenic
952411551 3:33054255-33054277 CAGCCCACACTGACTAAGACAGG + Intronic
954033381 3:47836437-47836459 CATCCCAGCCTGTCTGAAGCAGG + Intronic
954869971 3:53760430-53760452 GGGCCCAGCCTGTTTACAACGGG - Intronic
955151160 3:56368726-56368748 ATGCCCAGCTTGTCAAAAACAGG + Intronic
956681969 3:71789392-71789414 CAGACCAGCCTGGACAAAACAGG + Intergenic
957313430 3:78547466-78547488 AAGCACAGCCTGTCTAAGAGAGG - Intergenic
959121134 3:102233574-102233596 CAGCCCAGCCAGACTAATACAGG + Intronic
959436965 3:106327406-106327428 CAGCCCACACTGACTAAGACAGG + Intergenic
961122837 3:124387720-124387742 CAGCCCTGCCTGTATACAAAGGG + Intronic
961170421 3:124793875-124793897 GGGACCAGCATGTCTAAAACTGG - Intronic
962179283 3:133188698-133188720 TTACTCAGCCTGTCTAAAACAGG - Intronic
962399095 3:135041691-135041713 CAGCCCAAAATGACTAAAACAGG - Intronic
962804710 3:138918389-138918411 AAGACCAGCCTGGCTAACACGGG - Intergenic
963124110 3:141799092-141799114 CAGCCGAGCCAGCCTGAAACAGG + Intronic
963372747 3:144422404-144422426 GAGACCAGCCTGGCTAACACGGG + Intergenic
965121817 3:164569237-164569259 GAGACCATCCTGGCTAAAACGGG + Intergenic
966774542 3:183532425-183532447 CAGCCCAAGCTGACTAATACTGG + Intronic
966869089 3:184278378-184278400 CAGCCCAGCCTGCCTGTCACAGG - Intronic
968122334 3:196134477-196134499 CAGCCAAGTATGTCTATAACTGG + Intergenic
970274275 4:14380954-14380976 GAGACCAGCCTGGCCAAAACAGG + Intergenic
970652370 4:18193043-18193065 AAGCCCAATCTGTCTAAAAGAGG + Intergenic
970942573 4:21652391-21652413 CAGGCCTTCCTGTCTAAAATGGG + Intronic
971480450 4:27109857-27109879 CAGCCCAGCTTGATGAAAACTGG - Intergenic
971926684 4:33019401-33019423 CAGCCCAAGCTGACTAACACAGG - Intergenic
972344834 4:38183955-38183977 CCTCCCAGCCTGTCTACATCTGG - Intergenic
973714101 4:53657638-53657660 ATGCGCAGCCTGTTTAAAACAGG - Intronic
975421841 4:74173699-74173721 CAGCACAGCCTAGTTAAAACTGG - Intronic
976331220 4:83833028-83833050 GAGACCAGCCTGGCTAACACAGG + Intergenic
976632952 4:87258219-87258241 CAGGCCAAGATGTCTAAAACAGG - Intergenic
977295099 4:95201184-95201206 CTGCCCAAACTGTCTAAGACAGG + Intronic
978241675 4:106524222-106524244 CAGCACAGCTAGACTAAAACAGG + Intergenic
978427445 4:108597055-108597077 AAGACCAGCCTGGCCAAAACAGG + Intergenic
979203509 4:118007661-118007683 CAGCCCATCCTGTGGAACACAGG + Intergenic
980104741 4:128576980-128577002 CAGCCCATGCTGACTAACACAGG - Intergenic
980293638 4:130879141-130879163 AAGACCAGCCTGGCTAATACGGG - Intergenic
981664349 4:147206141-147206163 TAGCCCAACCTGACTAATACTGG + Intergenic
982092904 4:151896014-151896036 CAGCCCAGCCTGTGAAACACTGG - Intergenic
985622564 5:963104-963126 CAGCCCAGCCAGTCCATACCAGG - Intergenic
990716139 5:58639330-58639352 CAGCCCAAGCTGACTAAGACAGG - Intronic
991304095 5:65158352-65158374 CAGCCCAGGATGTCTAATAGTGG - Intronic
992553142 5:77878090-77878112 CAGCACATCAGGTCTAAAACGGG + Intergenic
992647412 5:78824497-78824519 CACCCCAGCCTGACTGAATCAGG + Intronic
993287009 5:86012321-86012343 AAGCCCAGCCTGGGCAAAACAGG + Intergenic
993297522 5:86161458-86161480 CAGCCCAAACTGACTAAGACAGG - Intergenic
994491094 5:100444857-100444879 GAGACCATCCTGGCTAAAACGGG - Intergenic
995226555 5:109707611-109707633 TTCCCCAGCCAGTCTAAAACAGG - Intronic
996316227 5:122163703-122163725 GATCCCAGGCTGTCAAAAACAGG - Intronic
996844144 5:127880778-127880800 GAGACCAGCCTGGCTAAAATGGG + Intergenic
999248896 5:150169897-150169919 CAGCCCCGCTTGTGTGAAACTGG - Intronic
999757302 5:154674236-154674258 CAGCCCATCCTGACTGATACAGG + Intergenic
1000618597 5:163458180-163458202 GAGACCAGCCTGGCTAACACGGG - Intronic
1001481442 5:172091855-172091877 CAGCCCTGCCTTCCTAACACGGG + Intronic
1005814909 6:29542650-29542672 CAGCCCAGCCCATCTGAGACAGG + Intergenic
1006277310 6:33015706-33015728 CAGCCCTTCCTGTTTAAAAGAGG + Intergenic
1006935920 6:37717569-37717591 CATCCCATCCTGTCTAGAACAGG + Intergenic
1007228322 6:40330201-40330223 CAGCCCAGCCTGTCAAGATCTGG + Intergenic
1010124531 6:72416729-72416751 CATCCCAACCTGTCTTAAAAAGG - Intergenic
1012013535 6:93824836-93824858 GAGACCATCCTGGCTAAAACAGG - Intergenic
1014403823 6:121023985-121024007 CAGCCCAAGCTGACTAATACAGG + Intergenic
1016468417 6:144349207-144349229 CAGACCATCCTGGCTAACACGGG - Intronic
1017023923 6:150165111-150165133 CAGCCCAAACTGACTAAGACAGG + Intronic
1017240054 6:152157956-152157978 CAGACCAGCCTGTCCAACATGGG - Intronic
1017894490 6:158667490-158667512 CAGCCCAGACTGGATAAAGCTGG - Intronic
1018803291 6:167239627-167239649 CATTCCAGCCTGTCTGACACAGG - Intergenic
1019208015 6:170378796-170378818 CAGCCCACCCTGCCCACAACCGG - Intronic
1019987573 7:4668859-4668881 AAGACCAGCCTGGCTAACACGGG + Intergenic
1021924794 7:25523886-25523908 CTGTCCACCCTGTCTAAAGCAGG - Intergenic
1021948470 7:25751923-25751945 CAGTTTAGTCTGTCTAAAACAGG + Intergenic
1022118234 7:27281420-27281442 GAGACCAGCCTGGCTAAAACGGG + Intergenic
1023833508 7:44054390-44054412 CAGACCAGCCTGGCCAACACAGG - Intronic
1023992639 7:45138343-45138365 CAGACCAGCCTGGCCAACACGGG - Intergenic
1024641371 7:51331567-51331589 CAGACCATCCTGGCTAACACAGG - Intergenic
1026799766 7:73392459-73392481 CAGCCCATCCTCTCTGATACTGG + Intergenic
1029242946 7:99177381-99177403 GAGACCAGCCTGGCTAACACAGG + Intronic
1029418749 7:100460837-100460859 CAGCCCAGCCTGGGCAACACAGG - Intronic
1033535266 7:142306466-142306488 GAGACCATCCTGGCTAAAACGGG - Intergenic
1034859449 7:154583147-154583169 CAGCCCAGGCAGCCTAAAACAGG - Intronic
1035471876 7:159115559-159115581 CAGGCAAGCCTGGCTGAAACAGG + Intronic
1036678621 8:10854304-10854326 CAGCCCAGACGGGCTAAGACAGG + Intergenic
1039805857 8:40997445-40997467 GAGCCCATCCTGGCTAACACAGG - Intergenic
1043609672 8:82046485-82046507 CAGGCCAGCCTGTTTAAGACTGG + Intergenic
1044104427 8:88185257-88185279 AAGACCAGCCTGGCTAACACGGG + Intronic
1046741398 8:117833036-117833058 CATCCCAGCTGTTCTAAAACAGG + Intronic
1047217105 8:122885063-122885085 CAGCCCTGCTTGTCTAACCCTGG - Intronic
1049040564 8:140109682-140109704 CATTCCACCCTGTCAAAAACTGG + Intronic
1049081364 8:140445732-140445754 AAGCCCAGCCTGTCTCAACTGGG + Intronic
1050215672 9:3320351-3320373 GAGACCAGCCTGGCCAAAACAGG + Intronic
1052932603 9:34067963-34067985 CACTCCAGCCTGGGTAAAACAGG + Intergenic
1057855809 9:98599884-98599906 CAGCCCGGTCTGGCTAAAGCAGG + Intronic
1057908594 9:99001355-99001377 GAGCCCAGCATTTCAAAAACTGG - Intronic
1058230072 9:102414949-102414971 CAGCCCAAACAGACTAAAACAGG - Intergenic
1058746909 9:108000611-108000633 CAGCCCAAACTGACTAAGACAGG - Intergenic
1060176447 9:121500328-121500350 GAGCCCAGAGTGTCTCAAACGGG + Intergenic
1061114558 9:128601180-128601202 GAGACCAGCCTGGCTAACACAGG - Intronic
1061448128 9:130653288-130653310 GAGACCAGCCTGAGTAAAACAGG + Intergenic
1062082538 9:134631919-134631941 CAGGCCAGCCTGGCTAATCCAGG - Intergenic
1062226909 9:135457513-135457535 CAGCCCAGGTTGCCTCAAACAGG - Intergenic
1185573592 X:1153023-1153045 GAGACCAGCCTGGCTAACACAGG + Intergenic
1187729187 X:22235358-22235380 CAGCCCAAACTGTCTAAAACAGG - Intronic
1189959577 X:46311631-46311653 AAGCCCATCCTTTATAAAACCGG - Intergenic
1190434508 X:50410062-50410084 CAGCCCAAACTGACTAAGACAGG + Intronic
1196759450 X:119188211-119188233 CAGCCCAGATGGTCTCAAACAGG + Intergenic
1198389612 X:136161082-136161104 GAACCCAGCCTGTCTATATCTGG - Intronic
1199494443 X:148437485-148437507 CAGCTCATCCTGACTAAAGCAGG - Intergenic
1201773645 Y:17642296-17642318 AAGACCAGCCTGTCTTGAACAGG - Intergenic
1201827911 Y:18263689-18263711 AAGACCAGCCTGTCTTGAACAGG + Intergenic