ID: 949202664

View in Genome Browser
Species Human (GRCh38)
Location 3:1397860-1397882
Sequence AACCCCATGCTGTTACTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949202664 Original CRISPR AACCCCATGCTGTTACTTAG AGG Intronic
905502887 1:38453478-38453500 AACCCCATGCTGTTAGTCCAAGG + Intergenic
906666288 1:47624418-47624440 AACCTCATGCTGGAACTCAGAGG - Intergenic
918092550 1:181310044-181310066 AAGCCCATGCTGTATCCTAGAGG - Intergenic
918339158 1:183552972-183552994 GACCCCATGCTGTTGCTTCTTGG - Exonic
919075915 1:192812710-192812732 AAGCCCATGCTGGTACTTGTGGG - Intergenic
919114239 1:193260606-193260628 AACTCCATCCTGTTACTGAGGGG - Intergenic
1062779786 10:191988-192010 AACCCCATGCTGTTGTTTTGAGG - Intronic
1063925046 10:10969311-10969333 ACCCCCAACCTGTGACTTAGTGG - Intergenic
1066552120 10:36570452-36570474 GATCCTATGCTGTTACTTGGTGG - Intergenic
1070256442 10:74816864-74816886 TGCTCCATGCAGTTACTTAGGGG + Intergenic
1071507889 10:86243744-86243766 AACCCCATGCTGTTAATGGGTGG - Intronic
1071726099 10:88199518-88199540 CACCCCATGATGGTACTCAGAGG + Intergenic
1072255581 10:93617292-93617314 ATCCCCATCCTGTAACTTAATGG + Intronic
1075133628 10:119762760-119762782 AATCCCCTGCAGTTACTGAGGGG + Intronic
1075166121 10:120069795-120069817 AACCCCATGGGGTTACTATGGGG + Intergenic
1075475330 10:122729163-122729185 AAGGTCATGCTGTTAGTTAGGGG - Intergenic
1076445962 10:130513995-130514017 TCCCCCATGCTGTTATTGAGTGG + Intergenic
1076778605 10:132711536-132711558 AACCCCATTCTGCTCCCTAGAGG + Intronic
1077018257 11:406411-406433 GACCCCATGCTGATTCTTCGAGG - Exonic
1078093629 11:8283417-8283439 ATCTCCATGCTGTCAATTAGAGG - Intergenic
1078177577 11:8981677-8981699 CACCCCATTCTCTTACCTAGCGG - Exonic
1083535155 11:63460374-63460396 AACCCCATGCTGCTGCTTCTTGG - Intergenic
1083588517 11:63877995-63878017 AACCGGATCCTGTTACTAAGTGG - Intronic
1085526597 11:77167614-77167636 AGCACCATGCTGTTGCTAAGGGG - Intronic
1087343483 11:96938453-96938475 CACCCCATGCTCTCACTTATAGG - Intergenic
1094323670 12:29212989-29213011 AAACCTATCCTGTGACTTAGTGG - Intronic
1101453499 12:104805235-104805257 CACCCAATGCTGTTAGGTAGGGG + Exonic
1101510336 12:105387348-105387370 AATCCCAAGCTGTTGCCTAGAGG - Intronic
1113651052 13:112034506-112034528 AATCCCAGGCTCTTACCTAGGGG + Intergenic
1114709648 14:24765617-24765639 AAGCCCATGCTGTCTCTTTGTGG - Intergenic
1121533432 14:94674388-94674410 AACACTATGTTGTTACTTAAAGG - Intergenic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1131643739 15:94319632-94319654 AAACCCATGCTTCTCCTTAGAGG + Intronic
1133658543 16:7891301-7891323 AGCACCATGCTTTTACTTTGGGG + Intergenic
1144258453 17:13493680-13493702 ATCCCCTTCCTGTTTCTTAGAGG - Intergenic
1145825939 17:27877401-27877423 AATCCCAGTCTGTCACTTAGTGG - Intronic
1146775406 17:35610113-35610135 TACCATATGGTGTTACTTAGGGG - Intronic
1148743066 17:49903706-49903728 ATTCCCTTGCTGTTAGTTAGAGG - Intergenic
1151129564 17:71882413-71882435 AACCCCATGCAGTGACCAAGTGG + Intergenic
1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG + Intronic
1161512986 19:4682170-4682192 AATCCCATGCAGTCACCTAGGGG - Intronic
1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG + Intronic
935384176 2:102484104-102484126 AACCCTTTGCTTTTACTAAGAGG + Intronic
940654189 2:156468579-156468601 AACCCCAAGATGTAACCTAGAGG - Intronic
942817734 2:180071735-180071757 AGCCCTGTGCTGTTCCTTAGTGG - Intergenic
945065736 2:205946402-205946424 AGCCACATCCTGTAACTTAGGGG - Intergenic
945986811 2:216361410-216361432 AATCCCTTGCTGTTACATATTGG + Intronic
948406697 2:237726831-237726853 AAGCCCATGCTTTGACTTAAGGG + Intronic
1170604693 20:17866759-17866781 AACCCCATTCTGTGACTTCCTGG + Intergenic
1171421134 20:25018431-25018453 AACCCCATACTCTTTCTGAGAGG + Intronic
1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG + Intergenic
1180390881 22:12280738-12280760 AACCCCTTGCTGTTGCTTTAGGG - Intergenic
1180408861 22:12584019-12584041 AACCCCTTGCTGTTGCTTTAGGG + Intergenic
1181455680 22:23058997-23059019 AACCCCATGCAGGTTCTTCGTGG - Intergenic
1183227329 22:36559358-36559380 TGCCCCATGCTGCTACTTTGAGG + Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949626589 3:5874192-5874214 AACTGCATGCTGTTAATAAGGGG + Intergenic
953243273 3:41168186-41168208 TAAGCCATGGTGTTACTTAGAGG + Intergenic
954015739 3:47688887-47688909 GACCCCAAGATTTTACTTAGAGG - Intronic
954751255 3:52815141-52815163 AAGACCCTGCTGTTACTCAGAGG + Intronic
959084354 3:101835256-101835278 AACCCCATGCTTTTAATCAAGGG + Intronic
960417221 3:117399322-117399344 AACCCCATGCTATTACCTGCTGG + Intergenic
965309348 3:167109933-167109955 CACACCATGCTCTTACTAAGAGG + Intergenic
967149401 3:186634868-186634890 TACCCCATGATGTTCTTTAGAGG + Intergenic
968794211 4:2691540-2691562 AGCCCCTGGCTGTCACTTAGGGG + Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
990450643 5:55929281-55929303 AAGCCCATGCTGTTTCTAAAGGG + Intergenic
992497549 5:77308669-77308691 AACTCCATGCTGTGACACAGTGG + Intronic
993571569 5:89546350-89546372 AAACACATGCTGTTAGTGAGTGG + Intergenic
994601047 5:101905677-101905699 AACCCCATGCTGTTCTTCAAGGG - Intergenic
995671213 5:114605064-114605086 GACCCCATGCTTTTGCGTAGAGG - Intergenic
995990759 5:118236314-118236336 AACCTCAAGCTGCTACTTACTGG + Intergenic
996624208 5:125550563-125550585 AACTCCATGCTGTTAAAAAGTGG + Intergenic
996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG + Intronic
997065018 5:130549505-130549527 AACCCAAGACTGTTATTTAGAGG - Intergenic
999586267 5:153092968-153092990 AAACCCAGGCTGTTTCTTTGAGG + Intergenic
999759151 5:154687011-154687033 AGCACCATGCTGTGACTGAGGGG - Intergenic
999914760 5:156245690-156245712 ATCCCCATGGTGTTATTTAATGG - Intronic
1004823751 6:19398535-19398557 AGCCCCATGCTATGACTTAAAGG + Intergenic
1006373032 6:33657079-33657101 AGCCACATGCTGTTGCTTTGTGG + Intronic
1006503441 6:34472936-34472958 AACCCCATGAGCTTACTAAGAGG - Intronic
1008417248 6:51256295-51256317 AACCCCATGATATTATTTACTGG + Intergenic
1022451673 7:30521941-30521963 AACCACATTCTATTATTTAGAGG + Intronic
1027391652 7:77709709-77709731 AACCAAATGCTGAAACTTAGTGG - Intronic
1031126309 7:117777167-117777189 AACACCATGCTGCTAGTTAGAGG - Intronic
1031913121 7:127538278-127538300 AAGGTCATTCTGTTACTTAGAGG - Intergenic
1034129726 7:148703923-148703945 ATCGCCATGCTGTTACTTTTTGG - Intronic
1035854124 8:2955479-2955501 AGCCTCATGCTCTTACTTATGGG + Intronic
1036234743 8:7028790-7028812 ATCCCCGTGCAGTTACTTACTGG + Intergenic
1048386348 8:133916206-133916228 AATCCCATGGAGTTACTTGGTGG - Intergenic
1048854386 8:138673966-138673988 AACGCCATGCAGTCACTCAGGGG + Intronic
1050563011 9:6853812-6853834 AACCCCAATCTGTCACTTACTGG + Intronic
1058488434 9:105467080-105467102 AAGGTCATGCTGTTACTGAGTGG + Intronic
1059879608 9:118675683-118675705 AACACCAAGCTGTTACACAGAGG - Intergenic
1186378685 X:9034215-9034237 AACCACGGGCTGTCACTTAGGGG - Intronic
1188910264 X:35839088-35839110 CACCCCATGCTGTGGCCTAGTGG - Intergenic
1195431434 X:104793903-104793925 ATCCCCATGTTGTTGATTAGTGG - Intronic
1197386116 X:125804489-125804511 TACCACATGTTGTTACTTATAGG + Intergenic
1198020664 X:132654448-132654470 AACCTCATGATGTTACAGAGAGG - Intronic