ID: 949204504

View in Genome Browser
Species Human (GRCh38)
Location 3:1421776-1421798
Sequence GTGATGTGAATGAGGCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949204502_949204504 4 Left 949204502 3:1421749-1421771 CCAGCTAACAGTAAAAACAAAAC No data
Right 949204504 3:1421776-1421798 GTGATGTGAATGAGGCTACCTGG No data
949204501_949204504 5 Left 949204501 3:1421748-1421770 CCCAGCTAACAGTAAAAACAAAA No data
Right 949204504 3:1421776-1421798 GTGATGTGAATGAGGCTACCTGG No data
949204499_949204504 22 Left 949204499 3:1421731-1421753 CCACAAGATGGGACTGCCCCAGC No data
Right 949204504 3:1421776-1421798 GTGATGTGAATGAGGCTACCTGG No data
949204500_949204504 6 Left 949204500 3:1421747-1421769 CCCCAGCTAACAGTAAAAACAAA No data
Right 949204504 3:1421776-1421798 GTGATGTGAATGAGGCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949204504 Original CRISPR GTGATGTGAATGAGGCTACC TGG Intergenic
No off target data available for this crispr