ID: 949211975

View in Genome Browser
Species Human (GRCh38)
Location 3:1513887-1513909
Sequence CAGGAGATTGGGGTTTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949211975_949211981 -4 Left 949211975 3:1513887-1513909 CCCTGGGAAACCCCAATCTCCTG No data
Right 949211981 3:1513906-1513928 CCTGTTCTTTCTGTAGCCTCAGG No data
949211975_949211983 22 Left 949211975 3:1513887-1513909 CCCTGGGAAACCCCAATCTCCTG No data
Right 949211983 3:1513932-1513954 ATAGAAACATTTTAACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949211975 Original CRISPR CAGGAGATTGGGGTTTCCCA GGG (reversed) Intergenic
No off target data available for this crispr