ID: 949212186

View in Genome Browser
Species Human (GRCh38)
Location 3:1516230-1516252
Sequence AGGCAACCAGCAGTCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949212181_949212186 5 Left 949212181 3:1516202-1516224 CCAATAGAGCAGCTCTATGCAGA No data
Right 949212186 3:1516230-1516252 AGGCAACCAGCAGTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949212186 Original CRISPR AGGCAACCAGCAGTCCTGGA GGG Intergenic
No off target data available for this crispr